Incidental Mutation 'R4595:Copg2'
ID344318
Institutional Source Beutler Lab
Gene Symbol Copg2
Ensembl Gene ENSMUSG00000025607
Gene Namecoatomer protein complex, subunit gamma 2
Synonyms
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R4595 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location30747554-30896794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30749450 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 814 (D814G)
Ref Sequence ENSEMBL: ENSMUSP00000038368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048774] [ENSMUST00000124665] [ENSMUST00000157040] [ENSMUST00000163949] [ENSMUST00000166192]
Predicted Effect probably damaging
Transcript: ENSMUST00000048774
AA Change: D814G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607
AA Change: D814G

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124665
SMART Domains Protein: ENSMUSP00000117713
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
Pfam:DUF1057 50 183 3.9e-9 PFAM
Pfam:Abhydrolase_6 79 198 7.8e-21 PFAM
Pfam:Abhydrolase_1 104 191 4.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000157040
SMART Domains Protein: ENSMUSP00000119038
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
Pfam:DUF1057 34 167 3.1e-9 PFAM
Pfam:Abhydrolase_6 63 182 6.2e-21 PFAM
Pfam:Abhydrolase_1 88 176 4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163949
SMART Domains Protein: ENSMUSP00000129639
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:DUF1057 43 176 7.1e-9 PFAM
Pfam:Abhydrolase_1 70 321 2.5e-16 PFAM
Pfam:Abhydrolase_5 71 315 5.9e-9 PFAM
Pfam:Abhydrolase_6 72 327 7.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166192
AA Change: D813G

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126726
Gene: ENSMUSG00000025607
AA Change: D813G

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 380 6.5e-92 PFAM
Meta Mutation Damage Score 0.1454 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Copg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02324:Copg2 APN 6 30863534 critical splice donor site probably null
IGL02511:Copg2 APN 6 30858822 missense probably benign 0.00
R0612:Copg2 UTSW 6 30861469 splice site probably null
R0723:Copg2 UTSW 6 30815982 missense possibly damaging 0.94
R0742:Copg2 UTSW 6 30863613 splice site probably null
R1708:Copg2 UTSW 6 30824377 missense probably damaging 1.00
R1775:Copg2 UTSW 6 30810336 missense probably damaging 1.00
R1826:Copg2 UTSW 6 30812842 missense probably benign 0.00
R2011:Copg2 UTSW 6 30816741 critical splice donor site probably null
R2170:Copg2 UTSW 6 30812822 frame shift probably null
R2358:Copg2 UTSW 6 30826233 nonsense probably null
R2393:Copg2 UTSW 6 30810958 missense probably benign 0.00
R2512:Copg2 UTSW 6 30896656 splice site probably null
R4613:Copg2 UTSW 6 30811596 missense probably benign
R5243:Copg2 UTSW 6 30750627 missense probably benign 0.01
R5293:Copg2 UTSW 6 30826227 missense probably damaging 0.98
R6019:Copg2 UTSW 6 30810933 missense possibly damaging 0.54
R6235:Copg2 UTSW 6 30816071 missense probably damaging 1.00
R6605:Copg2 UTSW 6 30858822 missense probably benign 0.31
R6857:Copg2 UTSW 6 30863598 missense possibly damaging 0.94
R7132:Copg2 UTSW 6 30815996 missense probably benign 0.00
R7216:Copg2 UTSW 6 30885600 missense probably damaging 0.99
R7223:Copg2 UTSW 6 30812754 nonsense probably null
R7288:Copg2 UTSW 6 30824406 missense probably damaging 1.00
R7588:Copg2 UTSW 6 30811591 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTGCCCCTAAAGGATAACC -3'
(R):5'- GGGCCTGTCTTCATCATCTGAC -3'

Sequencing Primer
(F):5'- CTAAGGAGAGCTGTAAAATCAACTC -3'
(R):5'- ATCAGCCATTTTCTAGGCTAGGAGC -3'
Posted On2015-09-25