Mutagenetix > Incidental Mutations

Incidental Mutation 'R0064:Vmn2r111'

34432

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

038356-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R0064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22572072 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 82 (I82L)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: I82L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: I82L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CATGACTGAATTCTCACCCTGCACC -3'
(R):5'- AAGCAATGGATGGACTCTAAGTGTTCTG -3'

Sequencing Primer
(F):5'- CCCAATTCAGGTTTGTAAGGGC -3'
(R):5'- AGTAGTGACATCTCGTTTATGAGAG -3'

Posted On

2013-05-09