Incidental Mutation 'R4595:Olfr622'
ID344320
Institutional Source Beutler Lab
Gene Symbol Olfr622
Ensembl Gene ENSMUSG00000050085
Gene Nameolfactory receptor 622
SynonymsMOR26-1, GA_x6K02T2PBJ9-6362863-6361910
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4595 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103638451-103642702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103640101 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 13 (F13S)
Ref Sequence ENSEMBL: ENSMUSP00000151149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058744] [ENSMUST00000213536] [ENSMUST00000216570]
Predicted Effect probably damaging
Transcript: ENSMUST00000058744
AA Change: F13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058312
Gene: ENSMUSG00000050085
AA Change: F13S

DomainStartEndE-ValueType
Pfam:7tm_4 32 312 4.2e-100 PFAM
Pfam:7TM_GPCR_Srsx 36 308 2.3e-6 PFAM
Pfam:7tm_1 42 293 6.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213536
AA Change: F13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216337
Predicted Effect probably damaging
Transcript: ENSMUST00000216570
AA Change: F13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6937 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Olfr622
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Olfr622 APN 7 103639832 missense probably damaging 1.00
IGL02972:Olfr622 APN 7 103639894 missense probably damaging 1.00
PIT4434001:Olfr622 UTSW 7 103639847 missense probably damaging 1.00
R1487:Olfr622 UTSW 7 103639594 missense probably damaging 1.00
R1989:Olfr622 UTSW 7 103639495 missense probably damaging 1.00
R3880:Olfr622 UTSW 7 103639624 missense probably benign 0.33
R4989:Olfr622 UTSW 7 103640101 missense probably damaging 1.00
R5715:Olfr622 UTSW 7 103639802 missense probably damaging 1.00
R5840:Olfr622 UTSW 7 103639256 missense probably benign 0.05
R6046:Olfr622 UTSW 7 103639679 missense probably benign 0.01
R6207:Olfr622 UTSW 7 103640002 missense probably benign 0.29
R6294:Olfr622 UTSW 7 103639591 missense probably damaging 1.00
R6392:Olfr622 UTSW 7 103639682 missense probably benign
R6522:Olfr622 UTSW 7 103639297 missense probably damaging 1.00
R6996:Olfr622 UTSW 7 103639858 missense probably benign 0.10
R7069:Olfr622 UTSW 7 103639960 missense probably damaging 0.99
R7251:Olfr622 UTSW 7 103639702 missense probably damaging 1.00
R7625:Olfr622 UTSW 7 103639958 missense probably damaging 1.00
X0018:Olfr622 UTSW 7 103639598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGTGCATCAAACCAGAAG -3'
(R):5'- GGTTGAGACAGCCCTTCTTG -3'

Sequencing Primer
(F):5'- TGCCAAGCATCTTCAGAGCTG -3'
(R):5'- ACAGCCCTTCTTGGAAAGTG -3'
Posted On2015-09-25