Incidental Mutation 'R4595:Micu3'
ID344324
Institutional Source Beutler Lab
Gene Symbol Micu3
Ensembl Gene ENSMUSG00000039478
Gene Namemitochondrial calcium uptake family, member 3
SynonymsEfha2, 2900075B16Rik
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4595 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40307458-40386308 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 40359397 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000068999]
Predicted Effect probably benign
Transcript: ENSMUST00000068999
SMART Domains Protein: ENSMUSP00000070241
Gene: ENSMUSG00000039478

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EFh 229 257 3.93e0 SMART
Blast:EFh 332 360 1e-5 BLAST
EFh 467 495 5.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132481
Predicted Effect probably benign
Transcript: ENSMUST00000136835
SMART Domains Protein: ENSMUSP00000118883
Gene: ENSMUSG00000039478

DomainStartEndE-ValueType
EFh 5 33 6.6e-2 SMART
Blast:EFh 71 99 9e-6 BLAST
EFh 206 234 5.36e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Micu3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Micu3 APN 8 40382130 missense possibly damaging 0.90
R0491:Micu3 UTSW 8 40366253 splice site probably benign
R1518:Micu3 UTSW 8 40335852 missense possibly damaging 0.94
R2089:Micu3 UTSW 8 40308372 missense probably benign 0.01
R3115:Micu3 UTSW 8 40382167 missense probably benign 0.21
R3893:Micu3 UTSW 8 40366224 missense probably damaging 1.00
R4026:Micu3 UTSW 8 40359455 intron probably benign
R4094:Micu3 UTSW 8 40335888 missense probably null 1.00
R4678:Micu3 UTSW 8 40380677 missense probably damaging 1.00
R5501:Micu3 UTSW 8 40354300 unclassified probably null
R6327:Micu3 UTSW 8 40366197 missense probably benign 0.13
R6793:Micu3 UTSW 8 40380695 missense probably damaging 0.99
R7292:Micu3 UTSW 8 40382125 missense probably benign 0.09
R7350:Micu3 UTSW 8 40348958 missense probably benign 0.09
R7427:Micu3 UTSW 8 40378914 missense possibly damaging 0.86
R7453:Micu3 UTSW 8 40335898 missense probably benign
R7635:Micu3 UTSW 8 40366234 missense possibly damaging 0.76
X0003:Micu3 UTSW 8 40366222 missense probably benign 0.00
Z1177:Micu3 UTSW 8 40308224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGGTCCTTTCATGTACAGTG -3'
(R):5'- GGTGGTTGTTTACTCACACTTAC -3'

Sequencing Primer
(F):5'- CGGTCCTTTCATGTACAGTGAAATG -3'
(R):5'- TCACATATCAAGAAATTCTGGCTTG -3'
Posted On2015-09-25