Incidental Mutation 'R4595:Zbtb16'
ID344327
Institutional Source Beutler Lab
Gene Symbol Zbtb16
Ensembl Gene ENSMUSG00000066687
Gene Namezinc finger and BTB domain containing 16
SynonymsGreen's luxoid, Zfp145, PLZF
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R4595 (G1)
Quality Score124
Status Validated
Chromosome9
Chromosomal Location48654297-48836222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48832080 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 311 (E311K)
Ref Sequence ENSEMBL: ENSMUSP00000150887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093852
AA Change: E311K

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: E311K

DomainStartEndE-ValueType
BTB 34 126 1.41e-24 SMART
ZnF_C2H2 404 426 3.72e0 SMART
ZnF_C2H2 432 454 8.22e-2 SMART
ZnF_C2H2 461 483 2.24e-3 SMART
ZnF_C2H2 490 512 1.56e-2 SMART
ZnF_C2H2 518 540 1.63e-5 SMART
ZnF_C2H2 546 568 1.95e-3 SMART
ZnF_C2H2 574 596 5.9e-3 SMART
ZnF_C2H2 602 624 2.36e-2 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000216150
AA Change: E311K

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.2203 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Zbtb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Zbtb16 APN 9 48657183 missense probably damaging 1.00
R0324:Zbtb16 UTSW 9 48665275 missense possibly damaging 0.82
R0364:Zbtb16 UTSW 9 48743576 splice site probably benign
R1538:Zbtb16 UTSW 9 48832283 missense probably benign
R1575:Zbtb16 UTSW 9 48832272 missense probably damaging 0.96
R1937:Zbtb16 UTSW 9 48659778 missense probably benign
R2656:Zbtb16 UTSW 9 48832688 missense probably damaging 1.00
R4176:Zbtb16 UTSW 9 48659801 missense probably damaging 1.00
R4582:Zbtb16 UTSW 9 48832082 missense probably benign
R6466:Zbtb16 UTSW 9 48665319 missense possibly damaging 0.95
R6966:Zbtb16 UTSW 9 48657354 missense probably damaging 1.00
R7596:Zbtb16 UTSW 9 48832404 missense possibly damaging 0.93
R7751:Zbtb16 UTSW 9 48743469 missense probably damaging 1.00
R7904:Zbtb16 UTSW 9 48832972 missense probably damaging 1.00
Z1176:Zbtb16 UTSW 9 48657288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAGCTCCCTCTGGATGAAG -3'
(R):5'- ATGCAGGTAGATGAAGCCCC -3'

Sequencing Primer
(F):5'- TCTGGATGAAGCCCTGAGG -3'
(R):5'- AGCTGAGTCTAGCATCTC -3'
Posted On2015-09-25