Incidental Mutation 'R4595:Slc6a4'
ID 344335
Institutional Source Beutler Lab
Gene Symbol Slc6a4
Ensembl Gene ENSMUSG00000020838
Gene Name solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Synonyms 5-HTT, Sert, Htt
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R4595 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 76998603-77032340 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77019863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 447 (I447V)
Ref Sequence ENSEMBL: ENSMUSP00000104039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021195] [ENSMUST00000108402]
AlphaFold Q60857
Predicted Effect probably benign
Transcript: ENSMUST00000021195
AA Change: I447V

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021195
Gene: ENSMUSG00000020838
AA Change: I447V

DomainStartEndE-ValueType
Pfam:5HT_transport_N 24 64 3e-27 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108402
AA Change: I447V

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104039
Gene: ENSMUSG00000020838
AA Change: I447V

DomainStartEndE-ValueType
Pfam:5HT_transporter 23 64 7.8e-30 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137819
Meta Mutation Damage Score 0.2356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit greatly diminished brain serotonin levels and lack cortical barrel patterns. Also, mutants lack the locomotor enhancing response to the drug (+)-3,4-methylenedioxymethamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Slc6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slc6a4 APN 11 77023180 missense probably benign 0.00
IGL01403:Slc6a4 APN 11 77031672 missense probably benign 0.00
IGL01608:Slc6a4 APN 11 77027135 missense probably damaging 1.00
IGL01759:Slc6a4 APN 11 77013288 missense probably damaging 1.00
IGL02239:Slc6a4 APN 11 77027156 missense probably benign 0.01
IGL02491:Slc6a4 APN 11 77027208 missense probably damaging 1.00
IGL03221:Slc6a4 APN 11 77027105 missense probably benign
R1122:Slc6a4 UTSW 11 77027186 missense possibly damaging 0.90
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1768:Slc6a4 UTSW 11 77013252 missense probably damaging 1.00
R1876:Slc6a4 UTSW 11 77015164 missense probably benign 0.34
R1884:Slc6a4 UTSW 11 77013375 missense probably benign 0.01
R4362:Slc6a4 UTSW 11 77017078 missense probably damaging 1.00
R4855:Slc6a4 UTSW 11 77013309 missense probably damaging 1.00
R5569:Slc6a4 UTSW 11 77023255 missense possibly damaging 0.88
R5747:Slc6a4 UTSW 11 77010511 missense probably damaging 0.97
R5802:Slc6a4 UTSW 11 77019236 missense probably damaging 1.00
R6242:Slc6a4 UTSW 11 77018358 nonsense probably null
R6344:Slc6a4 UTSW 11 77018254 missense probably damaging 1.00
R6443:Slc6a4 UTSW 11 77023201 missense probably benign 0.05
R6935:Slc6a4 UTSW 11 77027168 missense probably benign 0.06
R7283:Slc6a4 UTSW 11 77010696 missense probably benign
R7313:Slc6a4 UTSW 11 77010701 missense possibly damaging 0.75
R7347:Slc6a4 UTSW 11 77017085 nonsense probably null
R7535:Slc6a4 UTSW 11 77015150 missense possibly damaging 0.70
R7826:Slc6a4 UTSW 11 77013025 missense probably benign 0.27
R8055:Slc6a4 UTSW 11 77010598 missense probably benign 0.00
R9296:Slc6a4 UTSW 11 77018284 missense probably benign 0.19
R9325:Slc6a4 UTSW 11 77019173 missense probably benign 0.13
RF007:Slc6a4 UTSW 11 77019182 missense probably damaging 1.00
Z1177:Slc6a4 UTSW 11 77016683 frame shift probably null
Z1186:Slc6a4 UTSW 11 77010556 missense probably benign
Z1186:Slc6a4 UTSW 11 77013032 missense probably benign
Z1187:Slc6a4 UTSW 11 77010556 missense probably benign
Z1187:Slc6a4 UTSW 11 77013032 missense probably benign
Z1188:Slc6a4 UTSW 11 77010556 missense probably benign
Z1188:Slc6a4 UTSW 11 77013032 missense probably benign
Z1189:Slc6a4 UTSW 11 77010556 missense probably benign
Z1189:Slc6a4 UTSW 11 77013032 missense probably benign
Z1190:Slc6a4 UTSW 11 77010556 missense probably benign
Z1190:Slc6a4 UTSW 11 77013032 missense probably benign
Z1192:Slc6a4 UTSW 11 77010556 missense probably benign
Z1192:Slc6a4 UTSW 11 77013032 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAAAGGCTAGAGCTGTGTGC -3'
(R):5'- AAAGGACCCACTCTGCTTGTG -3'

Sequencing Primer
(F):5'- TGCCTGCAAGTCCTCAGTGATG -3'
(R):5'- TGGAACACTAGAGAATAGCAGAGGC -3'
Posted On 2015-09-25