Mutagenetix > Incidental Mutation

Incidental Mutation 'R0064:Mcc'

34434

Institutional Source

Beutler Lab

Gene Symbol

Mcc

Ensembl Gene

ENSMUSG00000071856

Gene Name

mutated in colorectal cancers

Synonyms

D18Ertd451e

MMRRC Submission

038356-MU

Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0064 (G1)

Quality Score

221

Status

Validated

Chromosome

Chromosomal Location

44425060-44812182 bp(-) (GRCm38)

Type of Mutation

critical splice donor site

DNA Base Change (assembly)

C to G at 44519516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089874] [ENSMUST00000089874] [ENSMUST00000164666] [ENSMUST00000164666]

AlphaFold

E9PWI3

Predicted Effect

probably benign
Transcript: ENSMUST00000089874

SMART Domains

Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
EFh	24	52	1.36e-3	SMART
EFh	57	85	7.36e0	SMART
coiled coil region	196	308	N/A	INTRINSIC
coiled coil region	395	466	N/A	INTRINSIC
low complexity region	488	493	N/A	INTRINSIC
low complexity region	512	517	N/A	INTRINSIC
low complexity region	523	537	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	577	641	2.6e-32	PFAM
low complexity region	715	731	N/A	INTRINSIC
coiled coil region	738	834	N/A	INTRINSIC
low complexity region	853	863	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	906	972	1.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089874

SMART Domains

Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
EFh	24	52	1.36e-3	SMART
EFh	57	85	7.36e0	SMART
coiled coil region	196	308	N/A	INTRINSIC
coiled coil region	395	466	N/A	INTRINSIC
low complexity region	488	493	N/A	INTRINSIC
low complexity region	512	517	N/A	INTRINSIC
low complexity region	523	537	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	577	641	2.6e-32	PFAM
low complexity region	715	731	N/A	INTRINSIC
coiled coil region	738	834	N/A	INTRINSIC
low complexity region	853	863	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	906	972	1.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164666

SMART Domains

Protein: ENSMUSP00000128032
Gene: ENSMUSG00000071856

Domain	Start	End	E-Value	Type
coiled coil region	21	133	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	233	289	1.2e-14	PFAM
low complexity region	313	318	N/A	INTRINSIC
low complexity region	337	342	N/A	INTRINSIC
low complexity region	348	362	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	401	467	3.8e-32	PFAM
low complexity region	540	556	N/A	INTRINSIC
coiled coil region	563	659	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	730	798	1.3e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164666

SMART Domains

Protein: ENSMUSP00000128032
Gene: ENSMUSG00000071856

Domain	Start	End	E-Value	Type
coiled coil region	21	133	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	233	289	1.2e-14	PFAM
low complexity region	313	318	N/A	INTRINSIC
low complexity region	337	342	N/A	INTRINSIC
low complexity region	348	362	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	401	467	3.8e-32	PFAM
low complexity region	540	556	N/A	INTRINSIC
coiled coil region	563	659	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	730	798	1.3e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202090

Meta Mutation Damage Score

0.1325

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Mcc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Mcc	APN	18	44449216	missense	possibly damaging	0.93
IGL00981:Mcc	APN	18	44449349	missense	probably damaging	0.99
IGL00985:Mcc	APN	18	44491239	missense	probably damaging	1.00
IGL01674:Mcc	APN	18	44491156	missense	probably benign	0.10
IGL01862:Mcc	APN	18	44759296	missense	probably benign	0.00
IGL01935:Mcc	APN	18	44519516	critical splice donor site	probably null
IGL02168:Mcc	APN	18	44449299	missense	probably damaging	0.97
IGL02449:Mcc	APN	18	44459958	missense	probably benign	0.10
IGL02613:Mcc	APN	18	44429954	missense	probably damaging	1.00
IGL02709:Mcc	APN	18	44445810	missense	possibly damaging	0.73
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0021:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0022:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0063:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0217:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0218:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0243:Mcc	UTSW	18	44759299	missense	probably benign
R0373:Mcc	UTSW	18	44475222	missense	probably benign	0.01
R0564:Mcc	UTSW	18	44468507	missense	probably damaging	1.00
R0604:Mcc	UTSW	18	44473756	missense	probably damaging	1.00
R0691:Mcc	UTSW	18	44445860	missense	possibly damaging	0.67
R0965:Mcc	UTSW	18	44724526	missense	probably benign	0.41
R1015:Mcc	UTSW	18	44724669	missense	probably benign
R1186:Mcc	UTSW	18	44759403	missense	probably benign
R1215:Mcc	UTSW	18	44468494	missense	possibly damaging	0.93
R1878:Mcc	UTSW	18	44468400	missense	possibly damaging	0.69
R1990:Mcc	UTSW	18	44491315	nonsense	probably null
R1991:Mcc	UTSW	18	44491315	nonsense	probably null
R1992:Mcc	UTSW	18	44491315	nonsense	probably null
R2186:Mcc	UTSW	18	44812078	missense	possibly damaging	0.71
R2189:Mcc	UTSW	18	44534230	missense	possibly damaging	0.93
R2258:Mcc	UTSW	18	44475136	missense	probably damaging	1.00
R2267:Mcc	UTSW	18	44519541	missense	probably damaging	0.99
R2310:Mcc	UTSW	18	44431366	missense	probably damaging	1.00
R2343:Mcc	UTSW	18	44459797	critical splice donor site	probably null
R2377:Mcc	UTSW	18	44519549	missense	probably damaging	1.00
R3110:Mcc	UTSW	18	44449263	missense	probably damaging	1.00
R3112:Mcc	UTSW	18	44449263	missense	probably damaging	1.00
R4135:Mcc	UTSW	18	44724640	missense	probably benign	0.03
R4404:Mcc	UTSW	18	44759298	missense	probably benign
R4600:Mcc	UTSW	18	44519520	missense	probably damaging	1.00
R4606:Mcc	UTSW	18	44468421	missense	probably damaging	0.96
R4721:Mcc	UTSW	18	44519556	missense	probably damaging	1.00
R5858:Mcc	UTSW	18	44510141	missense	probably damaging	0.98
R5997:Mcc	UTSW	18	44449321	missense	probably damaging	1.00
R6482:Mcc	UTSW	18	44445864	missense	possibly damaging	0.94
R6502:Mcc	UTSW	18	44468390	nonsense	probably null
R6502:Mcc	UTSW	18	44468391	missense	probably damaging	1.00
R6518:Mcc	UTSW	18	44661811	start gained	probably benign
R6796:Mcc	UTSW	18	44724560	missense	probably benign
R6846:Mcc	UTSW	18	44473640	missense	possibly damaging	0.63
R6879:Mcc	UTSW	18	44812112	missense	unknown
R7147:Mcc	UTSW	18	44493513	missense	probably damaging	0.99
R7475:Mcc	UTSW	18	44476236	missense	probably damaging	0.98
R7515:Mcc	UTSW	18	44493432	missense	probably benign	0.02
R7608:Mcc	UTSW	18	44491227	missense	possibly damaging	0.83
R8092:Mcc	UTSW	18	44759232	missense	probably benign	0.00
R8119:Mcc	UTSW	18	44468433	missense	possibly damaging	0.95
R8162:Mcc	UTSW	18	44449441	critical splice acceptor site	probably null
R8187:Mcc	UTSW	18	44534260	missense	possibly damaging	0.53
R8716:Mcc	UTSW	18	44449336	missense	possibly damaging	0.92
R8744:Mcc	UTSW	18	44724572	missense	probably benign
R9383:Mcc	UTSW	18	44442918	missense	probably benign	0.24
R9517:Mcc	UTSW	18	44661727	missense	probably damaging	1.00
R9570:Mcc	UTSW	18	44445858	missense	probably damaging	0.97
R9590:Mcc	UTSW	18	44459910	missense	possibly damaging	0.93
X0010:Mcc	UTSW	18	44429957	missense	possibly damaging	0.94
Z1177:Mcc	UTSW	18	44491246	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AAAGGCATCAGACTGTTGTCTGTCTC -3'
(R):5'- ACATAACCACATGTCCATCTTGTGCTC -3'

Sequencing Primer
(F):5'- GGGCATTCGCCTAGAACTTG -3'
(R):5'- GTCCATCTTGTGCTCTGTGTTC -3'

Posted On

2013-05-09