Incidental Mutation 'R4595:Ptch1'
ID 344344
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Name patched 1
Synonyms wig, Ptc, Ptc1, A230106A15Rik, Patched 1
MMRRC Submission 041811-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4595 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 63656142-63721274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63691422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 277 (D277G)
Ref Sequence ENSEMBL: ENSMUSP00000141298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000193953] [ENSMUST00000194663] [ENSMUST00000195106] [ENSMUST00000195258] [ENSMUST00000195756]
AlphaFold Q61115
Predicted Effect probably benign
Transcript: ENSMUST00000021921
AA Change: D262G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: D262G

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192155
AA Change: D125G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: D125G

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193953
AA Change: D125G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000194663
AA Change: D210G

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466
AA Change: D210G

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195106
AA Change: D277G

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141298
Gene: ENSMUSG00000021466
AA Change: D277G

DomainStartEndE-ValueType
low complexity region 38 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195258
AA Change: D155G

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466
AA Change: D155G

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195756
AA Change: D125G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223515
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
4921536K21Rik A G 11: 3,840,052 (GRCm39) I115T probably benign Het
Acads A T 5: 115,251,123 (GRCm39) N120K probably damaging Het
Aco1 T A 4: 40,167,139 (GRCm39) C118S probably benign Het
Alpk2 T C 18: 65,422,819 (GRCm39) T1493A probably damaging Het
AU018091 A G 7: 3,208,268 (GRCm39) Y480H possibly damaging Het
Brd4 A T 17: 32,417,896 (GRCm39) I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 (GRCm39) E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 (GRCm39) N368S probably benign Het
Cenpp A T 13: 49,794,710 (GRCm39) F152L probably benign Het
Cfap46 T A 7: 139,232,320 (GRCm39) D881V possibly damaging Het
Chmp7 A G 14: 69,958,678 (GRCm39) V212A probably damaging Het
Col9a2 A T 4: 120,902,352 (GRCm39) K196N probably benign Het
Copg2 T C 6: 30,749,449 (GRCm39) D814G probably damaging Het
Dcaf13 G A 15: 38,982,288 (GRCm39) G85R probably damaging Het
Dnah9 A G 11: 66,058,978 (GRCm39) S106P probably benign Het
Dpp8 A G 9: 64,983,085 (GRCm39) D739G probably damaging Het
Drd2 T A 9: 49,316,089 (GRCm39) M283K probably benign Het
Espl1 A G 15: 102,207,159 (GRCm39) T208A probably benign Het
Glul G A 1: 153,778,796 (GRCm39) G35D possibly damaging Het
Gm14412 T C 2: 177,007,005 (GRCm39) K297E unknown Het
Gm21976 A T 13: 98,442,318 (GRCm39) R120W probably damaging Het
Hipk3 T A 2: 104,271,622 (GRCm39) T437S probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Lipn T G 19: 34,058,750 (GRCm39) Y321D probably damaging Het
Lrwd1 A G 5: 136,152,810 (GRCm39) V484A probably benign Het
Madd T C 2: 90,998,009 (GRCm39) D673G possibly damaging Het
Marveld1 T A 19: 42,136,203 (GRCm39) L39Q probably damaging Het
Mfsd2b T C 12: 4,915,807 (GRCm39) T299A possibly damaging Het
Micu3 T C 8: 40,812,438 (GRCm39) probably benign Het
Mmp7 T C 9: 7,697,667 (GRCm39) V234A probably damaging Het
Nhsl1 T A 10: 18,403,357 (GRCm39) D1329E probably benign Het
Or4a15 C T 2: 89,193,669 (GRCm39) V35M probably damaging Het
Or4f14b T C 2: 111,774,997 (GRCm39) D268G possibly damaging Het
Or52a33 A G 7: 103,289,308 (GRCm39) F13S probably damaging Het
Pcdhb21 T A 18: 37,647,568 (GRCm39) D232E probably damaging Het
Pebp1 G T 5: 117,421,475 (GRCm39) D156E probably benign Het
Pik3cb A G 9: 98,937,459 (GRCm39) Y745H possibly damaging Het
Pld2 T C 11: 70,432,846 (GRCm39) L170P probably damaging Het
Rab11fip1 A T 8: 27,644,603 (GRCm39) M394K probably damaging Het
Rhoq T C 17: 87,271,754 (GRCm39) Y57H probably benign Het
Setbp1 T C 18: 78,900,731 (GRCm39) I979V probably benign Het
Slc6a4 A G 11: 76,910,689 (GRCm39) I447V probably benign Het
Sos2 T C 12: 69,663,663 (GRCm39) K607R probably damaging Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Syne2 A T 12: 76,013,845 (GRCm39) Q3012L possibly damaging Het
Taf1b T A 12: 24,550,441 (GRCm39) F9I possibly damaging Het
Tex35 T A 1: 156,926,909 (GRCm39) Y195F probably benign Het
Tnc T C 4: 63,913,982 (GRCm39) T1277A probably damaging Het
Tnfsf15 G T 4: 63,648,180 (GRCm39) Y153* probably null Het
Trim5 C A 7: 103,914,639 (GRCm39) V477F probably damaging Het
Trp73 A G 4: 154,148,874 (GRCm39) I245T probably damaging Het
Zbtb16 C T 9: 48,743,380 (GRCm39) E311K possibly damaging Het
Zmynd19 A G 2: 24,849,000 (GRCm39) D165G probably damaging Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63,674,989 (GRCm39) missense probably benign 0.00
IGL01084:Ptch1 APN 13 63,691,451 (GRCm39) missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63,659,495 (GRCm39) missense probably benign
IGL02260:Ptch1 APN 13 63,713,166 (GRCm39) unclassified probably benign
IGL02439:Ptch1 APN 13 63,692,910 (GRCm39) missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63,659,732 (GRCm39) missense probably benign 0.13
IGL02797:Ptch1 APN 13 63,681,421 (GRCm39) missense probably benign
R0463:Ptch1 UTSW 13 63,668,121 (GRCm39) missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63,691,294 (GRCm39) splice site probably benign
R0657:Ptch1 UTSW 13 63,661,565 (GRCm39) missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63,687,657 (GRCm39) missense probably benign 0.23
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1539:Ptch1 UTSW 13 63,689,101 (GRCm39) missense probably benign 0.00
R1616:Ptch1 UTSW 13 63,687,656 (GRCm39) missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63,659,841 (GRCm39) nonsense probably null
R1985:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R1986:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2024:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2025:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2026:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2027:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2096:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2097:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2100:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2105:Ptch1 UTSW 13 63,693,059 (GRCm39) missense probably benign
R2165:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2166:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2167:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2168:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2226:Ptch1 UTSW 13 63,661,485 (GRCm39) missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2504:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2507:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2696:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2698:Ptch1 UTSW 13 63,690,038 (GRCm39) missense probably damaging 1.00
R2698:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2971:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3410:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3708:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3744:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3745:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3783:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3784:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3785:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3807:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3950:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4013:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4015:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4016:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4017:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4035:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4083:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4084:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4179:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4625:Ptch1 UTSW 13 63,670,978 (GRCm39) missense probably benign 0.02
R4809:Ptch1 UTSW 13 63,661,522 (GRCm39) missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63,670,818 (GRCm39) missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63,670,866 (GRCm39) missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63,672,884 (GRCm39) missense probably benign 0.02
R5386:Ptch1 UTSW 13 63,692,857 (GRCm39) missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63,675,059 (GRCm39) missense probably benign
R5604:Ptch1 UTSW 13 63,672,936 (GRCm39) missense probably benign 0.01
R5846:Ptch1 UTSW 13 63,713,268 (GRCm39) unclassified probably benign
R5926:Ptch1 UTSW 13 63,692,869 (GRCm39) missense probably benign 0.01
R5945:Ptch1 UTSW 13 63,721,233 (GRCm39) utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63,672,929 (GRCm39) missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63,691,359 (GRCm39) missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63,661,503 (GRCm39) missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63,691,422 (GRCm39) missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63,670,918 (GRCm39) missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63,687,644 (GRCm39) missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63,672,881 (GRCm39) missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63,659,550 (GRCm39) missense probably benign 0.23
R7168:Ptch1 UTSW 13 63,659,874 (GRCm39) missense probably benign
R7257:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7258:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7259:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7368:Ptch1 UTSW 13 63,659,798 (GRCm39) missense probably benign 0.06
R7525:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7528:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7820:Ptch1 UTSW 13 63,670,875 (GRCm39) missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63,688,626 (GRCm39) missense probably damaging 0.98
R8373:Ptch1 UTSW 13 63,688,982 (GRCm39) missense probably damaging 1.00
R8398:Ptch1 UTSW 13 63,672,939 (GRCm39) missense probably benign 0.06
R8407:Ptch1 UTSW 13 63,662,057 (GRCm39) missense probably null 1.00
R8839:Ptch1 UTSW 13 63,689,038 (GRCm39) missense probably damaging 1.00
R9075:Ptch1 UTSW 13 63,681,335 (GRCm39) missense possibly damaging 0.87
R9476:Ptch1 UTSW 13 63,681,448 (GRCm39) missense probably benign 0.05
R9514:Ptch1 UTSW 13 63,675,071 (GRCm39) missense probably benign
R9528:Ptch1 UTSW 13 63,661,615 (GRCm39) missense probably benign 0.00
R9568:Ptch1 UTSW 13 63,689,987 (GRCm39) missense probably damaging 0.99
Z1177:Ptch1 UTSW 13 63,668,093 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGCCAAACGAAATCTTCAGG -3'
(R):5'- CCTTTATACTCAGGCCCCAG -3'

Sequencing Primer
(F):5'- CAAACGAAATCTTCAGGATGAAAATC -3'
(R):5'- ATACTCAGGCCCCAGAGTTTTG -3'
Posted On 2015-09-25