Incidental Mutation 'R4595:Brd4'
ID344351
Institutional Source Beutler Lab
Gene Symbol Brd4
Ensembl Gene ENSMUSG00000024002
Gene Namebromodomain containing 4
SynonymsHUNK1, MCAP, WI-11513
MMRRC Submission 041811-MU
Accession Numbers

Genbank: NM_020508.3; NM_198094.2; MGI: 1888520

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4595 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32196274-32284722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32198922 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 86 (I86N)
Ref Sequence ENSEMBL: ENSMUSP00000155477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003726] [ENSMUST00000119123] [ENSMUST00000121285] [ENSMUST00000230858]
Predicted Effect unknown
Transcript: ENSMUST00000003726
AA Change: I1177N
SMART Domains Protein: ENSMUSP00000003726
Gene: ENSMUSG00000024002
AA Change: I1177N

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1e-52 SMART
low complexity region 176 191 N/A INTRINSIC
low complexity region 198 224 N/A INTRINSIC
low complexity region 237 275 N/A INTRINSIC
low complexity region 295 305 N/A INTRINSIC
low complexity region 329 339 N/A INTRINSIC
BROMO 352 461 1.2e-48 SMART
coiled coil region 504 570 N/A INTRINSIC
Pfam:BET 611 675 6.4e-33 PFAM
low complexity region 701 722 N/A INTRINSIC
low complexity region 746 796 N/A INTRINSIC
low complexity region 828 854 N/A INTRINSIC
low complexity region 890 926 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
low complexity region 953 1005 N/A INTRINSIC
low complexity region 1013 1042 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1201 1212 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
coiled coil region 1261 1345 N/A INTRINSIC
Pfam:BRD4_CDT 1358 1400 3.8e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000119123
AA Change: I1176N
SMART Domains Protein: ENSMUSP00000113197
Gene: ENSMUSG00000024002
AA Change: I1176N

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121285
AA Change: I1176N
SMART Domains Protein: ENSMUSP00000113070
Gene: ENSMUSG00000024002
AA Change: I1176N

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230565
Predicted Effect probably damaging
Transcript: ENSMUST00000230858
AA Change: I86N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype Strain: 2674141
Lethality: E3-E8
FUNCTION: This gene was temporarily named bromodomain-containing 5 (Brd5) and was renamed bromodomain-containing 4 (Brd4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trap null mutation die soon after implantation. Heterozygotes exhibit impaired pre- and postnatal growth, head malformations, lack of subcutaneous fat, cataracts, and abnormal liver cells. [provided by MGI curators]
Allele List at MGI

All alleles(161) : Targeted(1) Gene trapped(160)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lipn T G 19: 34,081,350 Y321D probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Brd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Brd4 APN 17 32198675 splice site probably benign
IGL01758:Brd4 APN 17 32212829 unclassified probably benign
IGL02750:Brd4 APN 17 32198379 unclassified probably benign
IGL03066:Brd4 APN 17 32199088 intron probably benign
IGL03338:Brd4 APN 17 32213072 missense probably damaging 1.00
Admirable UTSW 17 32225583 missense unknown
H8562:Brd4 UTSW 17 32229403 splice site probably benign
P0035:Brd4 UTSW 17 32212838 critical splice donor site probably null
R0243:Brd4 UTSW 17 32224123 missense probably benign 0.15
R0281:Brd4 UTSW 17 32213540 unclassified probably benign
R0331:Brd4 UTSW 17 32202515 missense probably benign 0.01
R0722:Brd4 UTSW 17 32212982 missense possibly damaging 0.76
R0750:Brd4 UTSW 17 32220252 missense probably benign 0.09
R1544:Brd4 UTSW 17 32198672 splice site probably benign
R1920:Brd4 UTSW 17 32198086 unclassified probably benign
R1922:Brd4 UTSW 17 32198086 unclassified probably benign
R1957:Brd4 UTSW 17 32221366 missense possibly damaging 0.50
R2240:Brd4 UTSW 17 32213639 unclassified probably benign
R2316:Brd4 UTSW 17 32212910 missense probably benign 0.03
R2333:Brd4 UTSW 17 32221457 missense probably damaging 0.97
R3809:Brd4 UTSW 17 32211270 missense possibly damaging 0.72
R4273:Brd4 UTSW 17 32214782 missense probably benign
R4854:Brd4 UTSW 17 32220237 missense probably damaging 0.96
R4923:Brd4 UTSW 17 32199240 missense probably benign 0.38
R5014:Brd4 UTSW 17 32198398 unclassified probably benign
R5757:Brd4 UTSW 17 32201298 unclassified probably benign
R5979:Brd4 UTSW 17 32198726 missense probably benign 0.32
R6212:Brd4 UTSW 17 32202449 missense probably damaging 0.98
R6394:Brd4 UTSW 17 32224147 nonsense probably null
R6643:Brd4 UTSW 17 32198496 missense unknown
R7024:Brd4 UTSW 17 32221910 utr 3 prime probably benign
R7033:Brd4 UTSW 17 32199015 missense probably benign 0.13
R7220:Brd4 UTSW 17 32225583 missense unknown
R7682:Brd4 UTSW 17 32201160 missense unknown
R7731:Brd4 UTSW 17 32211224 missense possibly damaging 0.73
R7732:Brd4 UTSW 17 32221412 missense unknown
X0064:Brd4 UTSW 17 32201127 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GATGAGAGCACTGAAGCACC -3'
(R):5'- ACGTCCAGCCTAAGAAGCAG -3'

Sequencing Primer
(F):5'- GATGAGAGCACTGAAGCACCTACTAC -3'
(R):5'- CAGTCATGGGCCAAGGC -3'
Posted On2015-09-25