Incidental Mutation 'R4595:Lipn'
ID 344356
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Name lipase, family member N
Synonyms 2210418G03Rik, Lipl4
MMRRC Submission 041811-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4595 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 34067358-34084918 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 34081350 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 321 (Y321D)
Ref Sequence ENSEMBL: ENSMUSP00000025682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000148821]
AlphaFold Q3U4B4
Predicted Effect probably damaging
Transcript: ENSMUST00000025682
AA Change: Y321D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: Y321D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Meta Mutation Damage Score 0.9054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921536K21Rik A G 11: 3,890,052 I115T probably benign Het
Acads A T 5: 115,113,064 N120K probably damaging Het
Aco1 T A 4: 40,167,139 C118S probably benign Het
Alpk2 T C 18: 65,289,748 T1493A probably damaging Het
AU018091 A G 7: 3,158,428 Y480H possibly damaging Het
Brd4 A T 17: 32,198,922 I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 N368S probably benign Het
Cenpp A T 13: 49,641,234 F152L probably benign Het
Cfap46 T A 7: 139,652,404 D881V possibly damaging Het
Chmp7 A G 14: 69,721,229 V212A probably damaging Het
Col9a2 A T 4: 121,045,155 K196N probably benign Het
Copg2 T C 6: 30,749,450 D814G probably damaging Het
Dcaf13 G A 15: 39,118,893 G85R probably damaging Het
Dnah9 A G 11: 66,168,152 S106P probably benign Het
Dpp8 A G 9: 65,075,803 D739G probably damaging Het
Drd2 T A 9: 49,404,789 M283K probably benign Het
Espl1 A G 15: 102,298,724 T208A probably benign Het
Glul G A 1: 153,903,050 G35D possibly damaging Het
Gm14412 T C 2: 177,315,212 K297E unknown Het
Gm21976 A T 13: 98,305,810 R120W probably damaging Het
Hipk3 T A 2: 104,441,277 T437S probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lrwd1 A G 5: 136,123,956 V484A probably benign Het
Madd T C 2: 91,167,664 D673G possibly damaging Het
Marveld1 T A 19: 42,147,764 L39Q probably damaging Het
Mfsd2b T C 12: 4,865,807 T299A possibly damaging Het
Micu3 T C 8: 40,359,397 probably benign Het
Mmp7 T C 9: 7,697,666 V234A probably damaging Het
Nhsl1 T A 10: 18,527,609 D1329E probably benign Het
Olfr1234 C T 2: 89,363,325 V35M probably damaging Het
Olfr1307 T C 2: 111,944,652 D268G possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Pcdhb21 T A 18: 37,514,515 D232E probably damaging Het
Pebp1 G T 5: 117,283,410 D156E probably benign Het
Pik3cb A G 9: 99,055,406 Y745H possibly damaging Het
Pld2 T C 11: 70,542,020 L170P probably damaging Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rab11fip1 A T 8: 27,154,575 M394K probably damaging Het
Rhoq T C 17: 86,964,326 Y57H probably benign Het
Setbp1 T C 18: 78,857,516 I979V probably benign Het
Slc6a4 A G 11: 77,019,863 I447V probably benign Het
Sos2 T C 12: 69,616,889 K607R probably damaging Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Syne2 A T 12: 75,967,071 Q3012L possibly damaging Het
Taf1b T A 12: 24,500,442 F9I possibly damaging Het
Tex35 T A 1: 157,099,339 Y195F probably benign Het
Tnc T C 4: 63,995,745 T1277A probably damaging Het
Tnfsf15 G T 4: 63,729,943 Y153* probably null Het
Trim5 C A 7: 104,265,432 V477F probably damaging Het
Trp73 A G 4: 154,064,417 I245T probably damaging Het
Zbtb16 C T 9: 48,832,080 E311K possibly damaging Het
Zmynd19 A G 2: 24,958,988 D165G probably damaging Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34079035 missense probably benign 0.06
IGL01320:Lipn APN 19 34084640 missense probably benign 0.07
IGL01827:Lipn APN 19 34069480 missense probably damaging 1.00
IGL02252:Lipn APN 19 34071757 missense probably benign 0.01
IGL02422:Lipn APN 19 34068663 missense probably benign 0.00
R0081:Lipn UTSW 19 34076976 missense probably benign 0.00
R0284:Lipn UTSW 19 34080706 missense possibly damaging 0.87
R0539:Lipn UTSW 19 34084603 unclassified probably benign
R0749:Lipn UTSW 19 34076979 missense probably damaging 1.00
R1170:Lipn UTSW 19 34071758 missense probably benign 0.23
R1528:Lipn UTSW 19 34068670 missense probably damaging 0.96
R1621:Lipn UTSW 19 34068713 missense probably benign
R1675:Lipn UTSW 19 34080710 missense probably damaging 1.00
R1869:Lipn UTSW 19 34080739 missense possibly damaging 0.93
R3236:Lipn UTSW 19 34068738 missense probably benign 0.17
R3237:Lipn UTSW 19 34068738 missense probably benign 0.17
R3832:Lipn UTSW 19 34069533 critical splice donor site probably null
R3876:Lipn UTSW 19 34069428 missense probably benign 0.00
R4084:Lipn UTSW 19 34078940 missense probably benign 0.04
R5963:Lipn UTSW 19 34081300 missense probably damaging 0.97
R6018:Lipn UTSW 19 34076935 missense probably damaging 1.00
R6797:Lipn UTSW 19 34080760 missense probably benign
R7090:Lipn UTSW 19 34071780 missense possibly damaging 0.72
R7157:Lipn UTSW 19 34076990 nonsense probably null
R7458:Lipn UTSW 19 34071842 missense probably benign 0.10
R8824:Lipn UTSW 19 34084716 missense probably benign 0.04
R8894:Lipn UTSW 19 34084848 makesense probably null
R8933:Lipn UTSW 19 34069480 missense probably damaging 0.98
R9054:Lipn UTSW 19 34076976 missense possibly damaging 0.56
R9117:Lipn UTSW 19 34068641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCCCTCTGTTGGACAGC -3'
(R):5'- GGTAGAGTGAATGCAAGAGATTTACTC -3'

Sequencing Primer
(F):5'- GGACAGCATTCTCCATATTGATGAG -3'
(R):5'- GTCTGCATATAACAAATGAACACAG -3'
Posted On 2015-09-25