Mutagenetix > Incidental Mutation

Incidental Mutation 'R0064:Plce1'

34437

Institutional Source

Beutler Lab

Gene Symbol

Plce1

Ensembl Gene

ENSMUSG00000024998

Gene Name

phospholipase C, epsilon 1

Synonyms

4933403A21Rik, PLCepsilon

MMRRC Submission

038356-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.587) question?

Stock #

R0064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38481109-38785030 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 38780784 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481] [ENSMUST00000182481]

AlphaFold

Q8K4S1

Predicted Effect

probably null
Transcript: ENSMUST00000169713

SMART Domains

Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	7.6e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1561	1575	N/A	INTRINSIC
SCOP:d1qasa3	1634	1662	1e-3	SMART
low complexity region	1666	1680	N/A	INTRINSIC
PLCYc	1710	1826	4.28e-46	SMART
C2	1850	1948	3.7e-10	SMART
PDB:2BYE\|A	1986	2094	6e-47	PDB
RA	2115	2218	1.12e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000182267

SMART Domains

Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	5.9e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1552	1581	N/A	INTRINSIC
SCOP:d1qasa3	1648	1676	1e-3	SMART
low complexity region	1680	1694	N/A	INTRINSIC
PLCYc	1724	1840	4.28e-46	SMART
C2	1864	1962	3.7e-10	SMART
PDB:2BYE\|A	2000	2108	6e-47	PDB
RA	2129	2232	1.12e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000182481

SMART Domains

Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	8e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1561	1575	N/A	INTRINSIC
SCOP:d1qasa3	1634	1662	1e-3	SMART
low complexity region	1666	1680	N/A	INTRINSIC
PLCYc	1710	1826	4.28e-46	SMART
C2	1850	1948	3.7e-10	SMART
PDB:2BYE\|A	1986	2094	6e-47	PDB
RA	2115	2218	1.12e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000182481

SMART Domains

Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	8e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1561	1575	N/A	INTRINSIC
SCOP:d1qasa3	1634	1662	1e-3	SMART
low complexity region	1666	1680	N/A	INTRINSIC
PLCYc	1710	1826	4.28e-46	SMART
C2	1850	1948	3.7e-10	SMART
PDB:2BYE\|A	1986	2094	6e-47	PDB
RA	2115	2218	1.12e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182589

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Plce1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Plce1	APN	19	38745788	missense	probably damaging	0.99
IGL00336:Plce1	APN	19	38651906	missense	probably damaging	1.00
IGL00430:Plce1	APN	19	38725017	missense	probably damaging	1.00
IGL00466:Plce1	APN	19	38721029	missense	probably damaging	0.99
IGL00477:Plce1	APN	19	38525132	missense	probably benign	0.39
IGL00839:Plce1	APN	19	38698562	missense	probably damaging	1.00
IGL01292:Plce1	APN	19	38651785	splice site	probably benign
IGL01665:Plce1	APN	19	38524887	missense	probably benign	0.01
IGL01826:Plce1	APN	19	38739238	splice site	probably benign
IGL01833:Plce1	APN	19	38720981	missense	probably damaging	1.00
IGL02201:Plce1	APN	19	38769446	splice site	probably benign
IGL02276:Plce1	APN	19	38524757	missense	probably benign	0.05
IGL02477:Plce1	APN	19	38719553	splice site	probably benign
IGL02746:Plce1	APN	19	38698472	missense	probably damaging	1.00
Angel_food	UTSW	19	38727013	splice site	probably benign
Heavenly	UTSW	19	38777989	missense	probably damaging	1.00
R0058:Plce1	UTSW	19	38525184	missense	possibly damaging	0.90
R0058:Plce1	UTSW	19	38525184	missense	possibly damaging	0.90
R0116:Plce1	UTSW	19	38721821	missense	probably benign
R0138:Plce1	UTSW	19	38524419	missense	possibly damaging	0.49
R0240:Plce1	UTSW	19	38728886	missense	probably damaging	0.99
R0240:Plce1	UTSW	19	38728886	missense	probably damaging	0.99
R0504:Plce1	UTSW	19	38778021	splice site	probably benign
R0506:Plce1	UTSW	19	38760138	missense	probably benign	0.04
R0578:Plce1	UTSW	19	38777939	missense	probably damaging	1.00
R0645:Plce1	UTSW	19	38777989	missense	probably damaging	1.00
R0730:Plce1	UTSW	19	38716691	missense	probably damaging	0.98
R0920:Plce1	UTSW	19	38736521	missense	probably damaging	1.00
R1223:Plce1	UTSW	19	38702013	missense	probably damaging	1.00
R1223:Plce1	UTSW	19	38767226	missense	probably damaging	1.00
R1484:Plce1	UTSW	19	38705339	nonsense	probably null
R1488:Plce1	UTSW	19	38716803	missense	possibly damaging	0.92
R1598:Plce1	UTSW	19	38720996	missense	probably damaging	1.00
R1624:Plce1	UTSW	19	38724775	missense	probably damaging	1.00
R1732:Plce1	UTSW	19	38716838	missense	possibly damaging	0.56
R1778:Plce1	UTSW	19	38780790	splice site	probably benign
R1797:Plce1	UTSW	19	38758948	critical splice donor site	probably null
R1872:Plce1	UTSW	19	38760077	missense	probably damaging	1.00
R1876:Plce1	UTSW	19	38780623	missense	probably damaging	1.00
R1991:Plce1	UTSW	19	38777924	missense	probably damaging	1.00
R2080:Plce1	UTSW	19	38727013	splice site	probably benign
R2103:Plce1	UTSW	19	38777924	missense	probably damaging	1.00
R2376:Plce1	UTSW	19	38777986	missense	probably benign	0.02
R2471:Plce1	UTSW	19	38779926	missense	probably damaging	1.00
R2511:Plce1	UTSW	19	38760054	missense	probably damaging	1.00
R2842:Plce1	UTSW	19	38524283	missense	probably damaging	1.00
R3037:Plce1	UTSW	19	38777884	missense	probably damaging	0.98
R3104:Plce1	UTSW	19	38620519	missense	probably benign	0.00
R3700:Plce1	UTSW	19	38705337	missense	probably damaging	1.00
R3750:Plce1	UTSW	19	38777899	missense	probably benign
R3753:Plce1	UTSW	19	38651834	missense	probably benign	0.09
R4027:Plce1	UTSW	19	38524265	missense	probably damaging	1.00
R4057:Plce1	UTSW	19	38760119	missense	probably damaging	1.00
R4376:Plce1	UTSW	19	38705447	critical splice donor site	probably null
R4433:Plce1	UTSW	19	38767301	missense	probably damaging	1.00
R4520:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4521:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4522:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4524:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4650:Plce1	UTSW	19	38524644	missense	probably benign	0.30
R4673:Plce1	UTSW	19	38749396	missense	possibly damaging	0.51
R4701:Plce1	UTSW	19	38725007	missense	probably benign	0.33
R4828:Plce1	UTSW	19	38769499	missense	probably damaging	1.00
R5103:Plce1	UTSW	19	38767215	missense	probably damaging	1.00
R5112:Plce1	UTSW	19	38651833	missense	probably benign	0.00
R5236:Plce1	UTSW	19	38770347	missense	probably benign	0.11
R5268:Plce1	UTSW	19	38758835	missense	possibly damaging	0.71
R5288:Plce1	UTSW	19	38760091	missense	probably damaging	1.00
R5384:Plce1	UTSW	19	38760091	missense	probably damaging	1.00
R5386:Plce1	UTSW	19	38760091	missense	probably damaging	1.00
R5448:Plce1	UTSW	19	38779917	missense	probably damaging	1.00
R5452:Plce1	UTSW	19	38620482	missense	probably benign	0.01
R6004:Plce1	UTSW	19	38721871	missense	probably damaging	1.00
R6062:Plce1	UTSW	19	38524751	missense	probably benign
R6147:Plce1	UTSW	19	38702037	missense	probably damaging	1.00
R6247:Plce1	UTSW	19	38745845	missense	probably damaging	1.00
R6278:Plce1	UTSW	19	38725051	splice site	probably null
R6306:Plce1	UTSW	19	38769465	missense	probably damaging	1.00
R6317:Plce1	UTSW	19	38524530	nonsense	probably null
R6437:Plce1	UTSW	19	38525132	missense	probably benign	0.39
R6522:Plce1	UTSW	19	38748521	splice site	probably null
R7034:Plce1	UTSW	19	38739357	missense	probably damaging	1.00
R7036:Plce1	UTSW	19	38739357	missense	probably damaging	1.00
R7037:Plce1	UTSW	19	38702017	missense	probably damaging	1.00
R7069:Plce1	UTSW	19	38758940	missense	probably damaging	1.00
R7180:Plce1	UTSW	19	38779785	missense	probably damaging	1.00
R7189:Plce1	UTSW	19	38760137	missense	probably damaging	0.97
R7227:Plce1	UTSW	19	38726902	missense	probably benign	0.00
R7253:Plce1	UTSW	19	38698508	missense	probably damaging	1.00
R7278:Plce1	UTSW	19	38779896	missense	possibly damaging	0.58
R7287:Plce1	UTSW	19	38701903	missense	probably benign	0.02
R7422:Plce1	UTSW	19	38651885	missense	probably damaging	1.00
R7557:Plce1	UTSW	19	38765404	missense	probably benign	0.30
R7607:Plce1	UTSW	19	38524752	missense	probably benign
R7615:Plce1	UTSW	19	38524665	missense	probably benign	0.18
R7653:Plce1	UTSW	19	38749319	missense	probably benign	0.20
R7685:Plce1	UTSW	19	38748433	missense	probably benign	0.00
R7716:Plce1	UTSW	19	38716851	missense	probably benign
R7744:Plce1	UTSW	19	38620455	missense	possibly damaging	0.93
R7790:Plce1	UTSW	19	38780696	missense	probably damaging	0.97
R7921:Plce1	UTSW	19	38620553	missense	probably benign	0.03
R8070:Plce1	UTSW	19	38701839	missense	probably damaging	0.99
R8087:Plce1	UTSW	19	38736521	missense	probably damaging	1.00
R8116:Plce1	UTSW	19	38524818	missense	probably benign	0.32
R8178:Plce1	UTSW	19	38772979	missense	possibly damaging	0.93
R8321:Plce1	UTSW	19	38651936	missense	probably benign	0.00
R8416:Plce1	UTSW	19	38772997	missense	possibly damaging	0.77
R8544:Plce1	UTSW	19	38524459	missense	probably benign	0.00
R8713:Plce1	UTSW	19	38524901	missense	probably benign	0.01
R8850:Plce1	UTSW	19	38524367	missense	probably benign
R9217:Plce1	UTSW	19	38760107	missense	probably damaging	1.00
R9231:Plce1	UTSW	19	38716596	missense	probably benign	0.13
R9232:Plce1	UTSW	19	38716979	missense	probably benign	0.16
R9332:Plce1	UTSW	19	38737933	missense	probably damaging	1.00
R9473:Plce1	UTSW	19	38777893	missense	possibly damaging	0.93
R9474:Plce1	UTSW	19	38777893	missense	possibly damaging	0.93
R9475:Plce1	UTSW	19	38777893	missense	possibly damaging	0.93
R9476:Plce1	UTSW	19	38777893	missense	possibly damaging	0.93
R9751:Plce1	UTSW	19	38728970	missense	probably damaging	1.00
R9780:Plce1	UTSW	19	38620690	missense	possibly damaging	0.94
R9781:Plce1	UTSW	19	38525210	missense	probably damaging	1.00
RF018:Plce1	UTSW	19	38717207	missense	probably damaging	0.99
X0022:Plce1	UTSW	19	38726999	missense	probably damaging	1.00
X0065:Plce1	UTSW	19	38777914	missense	possibly damaging	0.48
Z1176:Plce1	UTSW	19	38701894	missense	probably damaging	1.00
Z1176:Plce1	UTSW	19	38724980	nonsense	probably null
Z1176:Plce1	UTSW	19	38769460	missense	probably damaging	1.00
Z1177:Plce1	UTSW	19	38651842	missense	probably null	0.48

Predicted Primers

PCR Primer
(F):5'- TCAAGAAGCTCACTAAGTCCACTAAGCA -3'
(R):5'- GTTAAGAAGAGACGAGGTTGTTGGGTC -3'

Sequencing Primer
(F):5'- TAAGTCCACTAAGCAGTCTCG -3'
(R):5'- gcagcaaacatctttaacccac -3'

Posted On

2013-05-09