Incidental Mutation 'R4596:Cfi'
ID344374
Institutional Source Beutler Lab
Gene Symbol Cfi
Ensembl Gene ENSMUSG00000058952
Gene Namecomplement component factor i
Synonyms
MMRRC Submission 041812-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4596 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location129835884-129875332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129868500 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 376 (V376A)
Ref Sequence ENSEMBL: ENSMUSP00000077074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077918]
Predicted Effect probably damaging
Transcript: ENSMUST00000077918
AA Change: V376A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: V376A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 4.63e-38 SMART
KAZAL 63 109 6.91e-3 SMART
SR 117 220 2.95e-22 SMART
LDLa 225 262 1.07e-4 SMART
LDLa 263 300 7.16e-6 SMART
low complexity region 317 326 N/A INTRINSIC
Tryp_SPc 360 589 3.33e-71 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,805 K429E probably benign Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adad1 T C 3: 37,065,192 S141P probably damaging Het
Anapc4 T C 5: 52,841,718 V124A probably benign Het
Anxa6 G T 11: 54,994,583 probably null Het
Arhgef40 T C 14: 51,987,224 probably null Het
Asz1 A T 6: 18,103,593 I116K possibly damaging Het
Bcam T C 7: 19,764,157 N314D probably damaging Het
Cipc A G 12: 86,961,954 T196A probably benign Het
Cnksr1 A G 4: 134,233,878 V225A possibly damaging Het
Col4a4 G A 1: 82,471,219 P1217S unknown Het
Dync2h1 C T 9: 6,992,595 D3996N probably benign Het
Fasl T C 1: 161,788,269 N6S probably benign Het
Fhod3 A T 18: 25,115,718 Q1318L probably benign Het
Gmps G T 3: 63,993,917 E386* probably null Het
Hspa13 C T 16: 75,758,226 G324D probably benign Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Itgb1bp1 C A 12: 21,272,134 L101F probably damaging Het
Jak3 T A 8: 71,684,631 S779T probably damaging Het
Klhl21 G T 4: 152,012,540 R421L probably benign Het
Mgat4c T C 10: 102,388,561 F212S probably damaging Het
Msl3l2 T A 10: 56,115,645 F155L probably benign Het
Nfat5 A G 8: 107,351,500 K406E possibly damaging Het
Nsd2 A T 5: 33,882,918 H933L probably damaging Het
Olfr1183 A G 2: 88,462,194 T304A probably benign Het
Olfr1497 G A 19: 13,794,900 T237I probably damaging Het
Olfr308 A T 7: 86,321,423 H176Q probably damaging Het
Olfr572 A G 7: 102,928,251 T208A possibly damaging Het
Paxbp1 T C 16: 91,030,547 I467V probably benign Het
Pcdha8 A C 18: 36,993,558 Q364H possibly damaging Het
Prr14l T C 5: 32,829,308 T948A probably benign Het
Ptgfr A T 3: 151,801,793 V311D probably damaging Het
Ptpn13 A G 5: 103,523,692 Y495C probably benign Het
Sec61g A T 11: 16,508,127 S23T probably benign Het
Sema3a G T 5: 13,570,157 V458F probably damaging Het
Slc16a14 T A 1: 84,929,357 E65D probably damaging Het
Slc35f6 T C 5: 30,648,062 M14T probably damaging Het
Slc4a10 A T 2: 62,296,858 I882F probably damaging Het
Sox17 C A 1: 4,492,637 E48D possibly damaging Het
Thbs1 A T 2: 118,114,755 I270F possibly damaging Het
Tia1 A G 6: 86,420,407 I121V probably benign Het
Trim30d A T 7: 104,472,526 H337Q probably benign Het
Tvp23b G A 11: 62,883,718 A63T probably benign Het
U2surp C T 9: 95,485,628 V437I probably damaging Het
Ube2i T C 17: 25,265,324 probably benign Het
Vmn1r62 A G 7: 5,675,307 probably benign Het
Wdr3 G A 3: 100,152,867 S310F possibly damaging Het
Wdr72 A T 9: 74,151,605 M327L probably benign Het
Other mutations in Cfi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cfi APN 3 129873095 missense probably damaging 0.97
IGL00659:Cfi APN 3 129836813 missense unknown
IGL01310:Cfi APN 3 129858431 missense probably damaging 1.00
IGL01387:Cfi APN 3 129874913 unclassified probably benign
IGL01897:Cfi APN 3 129858385 missense probably damaging 1.00
IGL02418:Cfi APN 3 129848812 missense probably benign 0.20
F5770:Cfi UTSW 3 129854992 missense possibly damaging 0.62
R0085:Cfi UTSW 3 129874986 missense probably benign 0.00
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0835:Cfi UTSW 3 129868542 missense probably damaging 1.00
R1191:Cfi UTSW 3 129868527 missense probably benign 0.01
R1221:Cfi UTSW 3 129872969 missense probably damaging 0.99
R1576:Cfi UTSW 3 129873050 missense probably damaging 0.98
R1809:Cfi UTSW 3 129873119 critical splice donor site probably null
R1940:Cfi UTSW 3 129858828 splice site probably benign
R1983:Cfi UTSW 3 129868545 missense probably damaging 1.00
R2069:Cfi UTSW 3 129858804 splice site probably null
R3012:Cfi UTSW 3 129874930 missense probably damaging 1.00
R4334:Cfi UTSW 3 129850829 missense possibly damaging 0.80
R4888:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5121:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5322:Cfi UTSW 3 129873040 missense probably damaging 1.00
R5673:Cfi UTSW 3 129855009 missense probably benign 0.02
R6084:Cfi UTSW 3 129858370 missense probably benign 0.00
R6364:Cfi UTSW 3 129872846 missense probably benign 0.36
R6770:Cfi UTSW 3 129858730 missense probably benign 0.21
R7000:Cfi UTSW 3 129872873 missense probably damaging 1.00
R7108:Cfi UTSW 3 129875016 missense probably damaging 1.00
R7194:Cfi UTSW 3 129855059 missense probably damaging 1.00
R7342:Cfi UTSW 3 129875132 missense probably damaging 1.00
R7470:Cfi UTSW 3 129855087 missense probably benign 0.01
R7538:Cfi UTSW 3 129858815 missense probably benign 0.08
R7908:Cfi UTSW 3 129848584 missense probably benign 0.01
R7954:Cfi UTSW 3 129868585 critical splice donor site probably null
R8017:Cfi UTSW 3 129855099 missense probably benign 0.00
R8135:Cfi UTSW 3 129855000 missense probably benign 0.00
R8155:Cfi UTSW 3 129855090 missense probably benign 0.00
R8217:Cfi UTSW 3 129855001 missense possibly damaging 0.61
R8530:Cfi UTSW 3 129850733 missense possibly damaging 0.79
R8767:Cfi UTSW 3 129850848 critical splice donor site probably null
V7580:Cfi UTSW 3 129854992 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCGCAGGAAACGAGTGATCG -3'
(R):5'- AGTTTCTCATGCAAGCCTTTG -3'

Sequencing Primer
(F):5'- CCAGCGAATGTGGTAAGTCTGC -3'
(R):5'- ATGCAAGCCTTTGTTTACCATG -3'
Posted On2015-09-25