Incidental Mutation 'R4596:Prr14l'
ID 344380
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms
MMRRC Submission 041812-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R4596 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 32789820-32854256 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32829308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 948 (T948A)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably benign
Transcript: ENSMUST00000120129
AA Change: T948A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: T948A

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155392
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,805 K429E probably benign Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adad1 T C 3: 37,065,192 S141P probably damaging Het
Anapc4 T C 5: 52,841,718 V124A probably benign Het
Anxa6 G T 11: 54,994,583 probably null Het
Arhgef40 T C 14: 51,987,224 probably null Het
Asz1 A T 6: 18,103,593 I116K possibly damaging Het
Bcam T C 7: 19,764,157 N314D probably damaging Het
Cfi T C 3: 129,868,500 V376A probably damaging Het
Cipc A G 12: 86,961,954 T196A probably benign Het
Cnksr1 A G 4: 134,233,878 V225A possibly damaging Het
Col4a4 G A 1: 82,471,219 P1217S unknown Het
Dync2h1 C T 9: 6,992,595 D3996N probably benign Het
Fasl T C 1: 161,788,269 N6S probably benign Het
Fhod3 A T 18: 25,115,718 Q1318L probably benign Het
Gmps G T 3: 63,993,917 E386* probably null Het
Hspa13 C T 16: 75,758,226 G324D probably benign Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Itgb1bp1 C A 12: 21,272,134 L101F probably damaging Het
Jak3 T A 8: 71,684,631 S779T probably damaging Het
Klhl21 G T 4: 152,012,540 R421L probably benign Het
Mgat4c T C 10: 102,388,561 F212S probably damaging Het
Msl3l2 T A 10: 56,115,645 F155L probably benign Het
Nfat5 A G 8: 107,351,500 K406E possibly damaging Het
Nsd2 A T 5: 33,882,918 H933L probably damaging Het
Olfr1183 A G 2: 88,462,194 T304A probably benign Het
Olfr1497 G A 19: 13,794,900 T237I probably damaging Het
Olfr308 A T 7: 86,321,423 H176Q probably damaging Het
Olfr572 A G 7: 102,928,251 T208A possibly damaging Het
Paxbp1 T C 16: 91,030,547 I467V probably benign Het
Pcdha8 A C 18: 36,993,558 Q364H possibly damaging Het
Ptgfr A T 3: 151,801,793 V311D probably damaging Het
Ptpn13 A G 5: 103,523,692 Y495C probably benign Het
Sec61g A T 11: 16,508,127 S23T probably benign Het
Sema3a G T 5: 13,570,157 V458F probably damaging Het
Slc16a14 T A 1: 84,929,357 E65D probably damaging Het
Slc35f6 T C 5: 30,648,062 M14T probably damaging Het
Slc4a10 A T 2: 62,296,858 I882F probably damaging Het
Sox17 C A 1: 4,492,637 E48D possibly damaging Het
Thbs1 A T 2: 118,114,755 I270F possibly damaging Het
Tia1 A G 6: 86,420,407 I121V probably benign Het
Trim30d A T 7: 104,472,526 H337Q probably benign Het
Tvp23b G A 11: 62,883,718 A63T probably benign Het
U2surp C T 9: 95,485,628 V437I probably damaging Het
Ube2i T C 17: 25,265,324 probably benign Het
Vmn1r62 A G 7: 5,675,307 probably benign Het
Wdr3 G A 3: 100,152,867 S310F possibly damaging Het
Wdr72 A T 9: 74,151,605 M327L probably benign Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
R9052:Prr14l UTSW 5 32830134 nonsense probably null
R9136:Prr14l UTSW 5 32828736 missense
Predicted Primers PCR Primer
(F):5'- CCTTGATGCTCACAATGAATGG -3'
(R):5'- TTCCTGGTTCTGAAGAGTTCAC -3'

Sequencing Primer
(F):5'- AGATACACCTGCTCTATCCAGTG -3'
(R):5'- CTGGTTCTGAAGAGTTCACACACAG -3'
Posted On 2015-09-25