Incidental Mutation 'R4596:U2surp'
ID344396
Institutional Source Beutler Lab
Gene Symbol U2surp
Ensembl Gene ENSMUSG00000032407
Gene NameU2 snRNP-associated SURP domain containing
Synonyms2610101N10Rik
MMRRC Submission 041812-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4596 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location95456898-95511996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95485628 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 437 (V437I)
Ref Sequence ENSEMBL: ENSMUSP00000151121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078374] [ENSMUST00000079659] [ENSMUST00000191213] [ENSMUST00000217176]
Predicted Effect probably damaging
Transcript: ENSMUST00000078374
AA Change: V394I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077482
Gene: ENSMUSG00000032407
AA Change: V394I

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
coiled coil region 148 186 N/A INTRINSIC
RRM 231 307 1.85e-18 SMART
low complexity region 313 323 N/A INTRINSIC
SWAP 384 438 1.07e-20 SMART
RPR 493 632 1.42e-41 SMART
internal_repeat_1 648 665 6.09e-7 PROSPERO
internal_repeat_1 678 698 6.09e-7 PROSPERO
coiled coil region 742 769 N/A INTRINSIC
cwf21 792 843 6.31e-17 SMART
low complexity region 881 933 N/A INTRINSIC
low complexity region 939 985 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079659
AA Change: V438I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078602
Gene: ENSMUSG00000032407
AA Change: V438I

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 1.85e-18 SMART
low complexity region 357 367 N/A INTRINSIC
SWAP 428 482 1.07e-20 SMART
RPR 537 676 1.42e-41 SMART
internal_repeat_1 692 709 1.14e-6 PROSPERO
internal_repeat_1 722 742 1.14e-6 PROSPERO
coiled coil region 786 813 N/A INTRINSIC
cwf21 836 887 6.31e-17 SMART
low complexity region 925 977 N/A INTRINSIC
low complexity region 983 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186139
Predicted Effect probably benign
Transcript: ENSMUST00000191213
AA Change: C423Y

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140614
Gene: ENSMUSG00000032407
AA Change: C423Y

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 7.8e-21 SMART
low complexity region 357 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217176
AA Change: V437I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,805 K429E probably benign Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adad1 T C 3: 37,065,192 S141P probably damaging Het
Anapc4 T C 5: 52,841,718 V124A probably benign Het
Anxa6 G T 11: 54,994,583 probably null Het
Arhgef40 T C 14: 51,987,224 probably null Het
Asz1 A T 6: 18,103,593 I116K possibly damaging Het
Bcam T C 7: 19,764,157 N314D probably damaging Het
Cfi T C 3: 129,868,500 V376A probably damaging Het
Cipc A G 12: 86,961,954 T196A probably benign Het
Cnksr1 A G 4: 134,233,878 V225A possibly damaging Het
Col4a4 G A 1: 82,471,219 P1217S unknown Het
Dync2h1 C T 9: 6,992,595 D3996N probably benign Het
Fasl T C 1: 161,788,269 N6S probably benign Het
Fhod3 A T 18: 25,115,718 Q1318L probably benign Het
Gmps G T 3: 63,993,917 E386* probably null Het
Hspa13 C T 16: 75,758,226 G324D probably benign Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Itgb1bp1 C A 12: 21,272,134 L101F probably damaging Het
Jak3 T A 8: 71,684,631 S779T probably damaging Het
Klhl21 G T 4: 152,012,540 R421L probably benign Het
Mgat4c T C 10: 102,388,561 F212S probably damaging Het
Msl3l2 T A 10: 56,115,645 F155L probably benign Het
Nfat5 A G 8: 107,351,500 K406E possibly damaging Het
Nsd2 A T 5: 33,882,918 H933L probably damaging Het
Olfr1183 A G 2: 88,462,194 T304A probably benign Het
Olfr1497 G A 19: 13,794,900 T237I probably damaging Het
Olfr308 A T 7: 86,321,423 H176Q probably damaging Het
Olfr572 A G 7: 102,928,251 T208A possibly damaging Het
Paxbp1 T C 16: 91,030,547 I467V probably benign Het
Pcdha8 A C 18: 36,993,558 Q364H possibly damaging Het
Prr14l T C 5: 32,829,308 T948A probably benign Het
Ptgfr A T 3: 151,801,793 V311D probably damaging Het
Ptpn13 A G 5: 103,523,692 Y495C probably benign Het
Sec61g A T 11: 16,508,127 S23T probably benign Het
Sema3a G T 5: 13,570,157 V458F probably damaging Het
Slc16a14 T A 1: 84,929,357 E65D probably damaging Het
Slc35f6 T C 5: 30,648,062 M14T probably damaging Het
Slc4a10 A T 2: 62,296,858 I882F probably damaging Het
Sox17 C A 1: 4,492,637 E48D possibly damaging Het
Thbs1 A T 2: 118,114,755 I270F possibly damaging Het
Tia1 A G 6: 86,420,407 I121V probably benign Het
Trim30d A T 7: 104,472,526 H337Q probably benign Het
Tvp23b G A 11: 62,883,718 A63T probably benign Het
Ube2i T C 17: 25,265,324 probably benign Het
Vmn1r62 A G 7: 5,675,307 probably benign Het
Wdr3 G A 3: 100,152,867 S310F possibly damaging Het
Wdr72 A T 9: 74,151,605 M327L probably benign Het
Other mutations in U2surp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:U2surp APN 9 95461524 utr 3 prime probably benign
IGL01122:U2surp APN 9 95490234 missense probably benign 0.02
IGL01985:U2surp APN 9 95490226 missense probably damaging 1.00
IGL01992:U2surp APN 9 95464419 missense possibly damaging 0.46
IGL01992:U2surp APN 9 95482181 missense probably damaging 0.99
IGL02300:U2surp APN 9 95488770 missense probably damaging 1.00
IGL02491:U2surp APN 9 95490220 missense probably damaging 0.98
IGL02503:U2surp APN 9 95502569 missense probably benign 0.03
IGL02615:U2surp APN 9 95493231 missense probably benign 0.00
IGL02628:U2surp APN 9 95472090 missense possibly damaging 0.89
IGL02682:U2surp APN 9 95481651 critical splice donor site probably null
IGL02721:U2surp APN 9 95474435 missense probably benign 0.10
IGL03200:U2surp APN 9 95491391 nonsense probably null
coup UTSW 9 95477512 missense probably damaging 1.00
R0095:U2surp UTSW 9 95500684 splice site probably null
R0373:U2surp UTSW 9 95484443 missense probably benign 0.08
R0376:U2surp UTSW 9 95484443 missense probably benign 0.08
R0377:U2surp UTSW 9 95484443 missense probably benign 0.08
R0416:U2surp UTSW 9 95485607 missense probably damaging 1.00
R0682:U2surp UTSW 9 95484443 missense probably benign 0.08
R0948:U2surp UTSW 9 95461497 utr 3 prime probably benign
R1420:U2surp UTSW 9 95462803 missense probably benign 0.33
R1474:U2surp UTSW 9 95493198 missense possibly damaging 0.49
R1555:U2surp UTSW 9 95466577 missense probably damaging 1.00
R1597:U2surp UTSW 9 95481740 splice site probably benign
R1638:U2surp UTSW 9 95484227 missense possibly damaging 0.95
R1693:U2surp UTSW 9 95511860 start codon destroyed probably null 0.53
R1851:U2surp UTSW 9 95482097 nonsense probably null
R2271:U2surp UTSW 9 95491420 missense possibly damaging 0.80
R2679:U2surp UTSW 9 95476232 missense possibly damaging 0.82
R2851:U2surp UTSW 9 95500682 splice site probably null
R3769:U2surp UTSW 9 95493697 splice site probably benign
R4672:U2surp UTSW 9 95493145 missense possibly damaging 0.83
R4763:U2surp UTSW 9 95511791 intron probably benign
R4995:U2surp UTSW 9 95462794 utr 3 prime probably benign
R5805:U2surp UTSW 9 95479304 missense possibly damaging 0.51
R6006:U2surp UTSW 9 95479307 missense probably damaging 0.96
R6249:U2surp UTSW 9 95500816 missense probably benign 0.07
R6260:U2surp UTSW 9 95476157 missense probably damaging 0.99
R6378:U2surp UTSW 9 95491421 missense probably benign 0.41
R6487:U2surp UTSW 9 95477512 missense probably damaging 1.00
R6585:U2surp UTSW 9 95472071 missense probably damaging 1.00
R6721:U2surp UTSW 9 95491104 missense probably damaging 0.99
R6760:U2surp UTSW 9 95493711 missense probably benign 0.27
R7065:U2surp UTSW 9 95485659 missense probably benign 0.01
R7167:U2surp UTSW 9 95481673 missense probably damaging 0.98
R7219:U2surp UTSW 9 95490162 nonsense probably null
R7232:U2surp UTSW 9 95493717 missense probably benign 0.03
R7460:U2surp UTSW 9 95462824 missense unknown
R7547:U2surp UTSW 9 95479349 missense possibly damaging 0.94
R7609:U2surp UTSW 9 95485679 splice site probably null
R7761:U2surp UTSW 9 95488761 missense probably damaging 1.00
X0018:U2surp UTSW 9 95475288 missense probably benign 0.14
X0018:U2surp UTSW 9 95485597 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGCCAAAGGACAATACTTGG -3'
(R):5'- GCCTTTAGTGTGTGCTCCAC -3'

Sequencing Primer
(F):5'- TGGAAATCTTTTCACTCTCCCAAAAC -3'
(R):5'- CTGCACCATTTTAGTAACTTAAG -3'
Posted On2015-09-25