Incidental Mutation 'R4597:Kif26b'
ID344418
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
MMRRC Submission 041813-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4597 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 178916793 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1485 (S1485C)
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]
Predicted Effect probably damaging
Transcript: ENSMUST00000160789
AA Change: S1038C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: S1038C

DomainStartEndE-ValueType
KISc 1 362 2.48e-42 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
low complexity region 460 466 N/A INTRINSIC
low complexity region 560 600 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 1038 1048 N/A INTRINSIC
low complexity region 1294 1322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161017
AA Change: S1485C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: S1485C

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162545
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4931422A03Rik T A 2: 104,026,155 probably benign Het
Adh5 T C 3: 138,445,357 V27A probably damaging Het
Ank2 A T 3: 126,988,151 D843E probably damaging Het
Arid2 A G 15: 96,370,856 N950S probably damaging Het
Arl1 A T 10: 88,730,746 probably benign Het
Bcl3 T G 7: 19,812,503 I136L probably damaging Het
C130060K24Rik T C 6: 65,447,424 probably null Het
Car9 T A 4: 43,509,138 S235R probably damaging Het
Carnmt1 G T 19: 18,671,087 G30W probably damaging Het
Casp12 C T 9: 5,348,941 T101I possibly damaging Het
Cdh23 A G 10: 60,409,044 L1026P probably damaging Het
Clec10a A T 11: 70,169,980 Y186F probably damaging Het
Col22a1 G T 15: 71,964,662 A508E possibly damaging Het
Crocc G C 4: 141,019,777 S1573R probably damaging Het
Cttnbp2nl G T 3: 105,005,875 T231K possibly damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Ehbp1l1 T C 19: 5,717,927 E1116G possibly damaging Het
Fam83d T C 2: 158,785,222 V277A possibly damaging Het
Fga G T 3: 83,031,235 G306* probably null Het
Fkbp9 A G 6: 56,832,382 Y59C probably damaging Het
Frmpd1 A G 4: 45,274,441 T450A probably benign Het
Gabbr1 A G 17: 37,056,899 M414V possibly damaging Het
Gm15448 T A 7: 3,822,155 Y496F possibly damaging Het
Gm16506 A G 14: 43,725,115 F112L unknown Het
Gm27047 T C 6: 130,630,336 noncoding transcript Het
Gm4353 T A 7: 116,083,612 K245* probably null Het
Gm4950 A T 18: 51,865,793 I30N probably benign Het
Gm8298 T A 3: 59,876,793 M229K possibly damaging Het
H2-M10.2 T C 17: 36,285,393 T187A probably benign Het
H60c A T 10: 3,259,968 N106K possibly damaging Het
Hist1h1b A T 13: 21,780,511 V15E probably damaging Het
Hoxa6 T C 6: 52,208,407 probably null Het
Ighv1-74 A G 12: 115,802,656 C115R probably damaging Het
Il17a G A 1: 20,730,993 probably null Het
Itga9 T C 9: 118,843,514 Y199H probably damaging Het
Itpr3 C T 17: 27,093,283 R554C probably damaging Het
Kcnc3 T A 7: 44,595,816 M510K probably damaging Het
Kif15 A G 9: 122,993,849 T432A probably benign Het
Klhl2 C A 8: 64,754,387 G313W probably damaging Het
Klhl32 C T 4: 24,629,339 S476N probably benign Het
Krt1 C T 15: 101,847,628 E386K possibly damaging Het
Lats1 T C 10: 7,691,746 S94P probably benign Het
Ltf G A 9: 111,022,933 C146Y probably damaging Het
Mars A G 10: 127,300,453 L501P probably damaging Het
Myh2 A C 11: 67,189,418 I1153L probably benign Het
Ncstn A T 1: 172,068,256 Y522* probably null Het
Nipal4 A G 11: 46,151,329 V175A probably damaging Het
Olfr860 T C 9: 19,845,691 I309M probably benign Het
Pcdha1 C G 18: 36,931,906 A541G possibly damaging Het
Pex11g A G 8: 3,464,043 Y40H probably damaging Het
Rin2 G T 2: 145,860,905 R507L probably benign Het
Sh2b2 T C 5: 136,231,762 D200G probably damaging Het
Smg7 C A 1: 152,840,301 probably null Het
Snx17 T C 5: 31,198,513 probably benign Het
Sos1 T C 17: 80,433,826 Y510C probably benign Het
Spata31d1c T A 13: 65,035,613 L323* probably null Het
Supt16 C T 14: 52,173,589 G686D probably damaging Het
Szt2 C T 4: 118,372,681 R2751H unknown Het
Tnfsf8 A G 4: 63,837,100 L95P probably damaging Het
Vmn2r17 A G 5: 109,429,562 H493R probably benign Het
Zfp770 C T 2: 114,196,770 A273T possibly damaging Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1386:Kif26b UTSW 1 178915644 missense probably benign
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3832:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4551:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R5589:Kif26b UTSW 1 178916299 missense probably benign 0.05
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178874138 missense probably damaging 1.00
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178917654 missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
R7506:Kif26b UTSW 1 178529499 start gained probably benign
R7562:Kif26b UTSW 1 178914976 missense probably damaging 1.00
R7583:Kif26b UTSW 1 178530445 nonsense probably null
R7585:Kif26b UTSW 1 178916496 missense probably benign 0.01
R7644:Kif26b UTSW 1 178679274 missense probably benign 0.04
R7759:Kif26b UTSW 1 178678944 missense probably damaging 1.00
R7775:Kif26b UTSW 1 178864876 missense probably benign 0.15
R8012:Kif26b UTSW 1 178916250 missense probably benign 0.20
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Z1177:Kif26b UTSW 1 178821548 missense probably benign 0.11
Z1177:Kif26b UTSW 1 178821550 nonsense probably null
Z1177:Kif26b UTSW 1 178915405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACGTGCAAGAGCCTGAGTC -3'
(R):5'- TTCTGAAATGCCCTTGGGAG -3'

Sequencing Primer
(F):5'- AAGAGCCTGAGTCCTCCACTG -3'
(R):5'- CCTTGGGAGGCTGCTTGAC -3'
Posted On2015-09-25