Incidental Mutation 'R4597:Fga'
ID344424
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission 041813-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R4597 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 83031235 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 306 (G306*)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably null
Transcript: ENSMUST00000029630
AA Change: G306*
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: G306*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166581
AA Change: G306*
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: G306*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4931422A03Rik T A 2: 104,026,155 probably benign Het
Adh5 T C 3: 138,445,357 V27A probably damaging Het
Ank2 A T 3: 126,988,151 D843E probably damaging Het
Arid2 A G 15: 96,370,856 N950S probably damaging Het
Arl1 A T 10: 88,730,746 probably benign Het
Bcl3 T G 7: 19,812,503 I136L probably damaging Het
C130060K24Rik T C 6: 65,447,424 probably null Het
Car9 T A 4: 43,509,138 S235R probably damaging Het
Carnmt1 G T 19: 18,671,087 G30W probably damaging Het
Casp12 C T 9: 5,348,941 T101I possibly damaging Het
Cdh23 A G 10: 60,409,044 L1026P probably damaging Het
Clec10a A T 11: 70,169,980 Y186F probably damaging Het
Col22a1 G T 15: 71,964,662 A508E possibly damaging Het
Crocc G C 4: 141,019,777 S1573R probably damaging Het
Cttnbp2nl G T 3: 105,005,875 T231K possibly damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Ehbp1l1 T C 19: 5,717,927 E1116G possibly damaging Het
Fam83d T C 2: 158,785,222 V277A possibly damaging Het
Fkbp9 A G 6: 56,832,382 Y59C probably damaging Het
Frmpd1 A G 4: 45,274,441 T450A probably benign Het
Gabbr1 A G 17: 37,056,899 M414V possibly damaging Het
Gm15448 T A 7: 3,822,155 Y496F possibly damaging Het
Gm16506 A G 14: 43,725,115 F112L unknown Het
Gm27047 T C 6: 130,630,336 noncoding transcript Het
Gm4353 T A 7: 116,083,612 K245* probably null Het
Gm4950 A T 18: 51,865,793 I30N probably benign Het
Gm8298 T A 3: 59,876,793 M229K possibly damaging Het
H2-M10.2 T C 17: 36,285,393 T187A probably benign Het
H60c A T 10: 3,259,968 N106K possibly damaging Het
Hist1h1b A T 13: 21,780,511 V15E probably damaging Het
Hoxa6 T C 6: 52,208,407 probably null Het
Ighv1-74 A G 12: 115,802,656 C115R probably damaging Het
Il17a G A 1: 20,730,993 probably null Het
Itga9 T C 9: 118,843,514 Y199H probably damaging Het
Itpr3 C T 17: 27,093,283 R554C probably damaging Het
Kcnc3 T A 7: 44,595,816 M510K probably damaging Het
Kif15 A G 9: 122,993,849 T432A probably benign Het
Kif26b A T 1: 178,916,793 S1485C probably damaging Het
Klhl2 C A 8: 64,754,387 G313W probably damaging Het
Klhl32 C T 4: 24,629,339 S476N probably benign Het
Krt1 C T 15: 101,847,628 E386K possibly damaging Het
Lats1 T C 10: 7,691,746 S94P probably benign Het
Ltf G A 9: 111,022,933 C146Y probably damaging Het
Mars A G 10: 127,300,453 L501P probably damaging Het
Myh2 A C 11: 67,189,418 I1153L probably benign Het
Ncstn A T 1: 172,068,256 Y522* probably null Het
Nipal4 A G 11: 46,151,329 V175A probably damaging Het
Olfr860 T C 9: 19,845,691 I309M probably benign Het
Pcdha1 C G 18: 36,931,906 A541G possibly damaging Het
Pex11g A G 8: 3,464,043 Y40H probably damaging Het
Rin2 G T 2: 145,860,905 R507L probably benign Het
Sh2b2 T C 5: 136,231,762 D200G probably damaging Het
Smg7 C A 1: 152,840,301 probably null Het
Snx17 T C 5: 31,198,513 probably benign Het
Sos1 T C 17: 80,433,826 Y510C probably benign Het
Spata31d1c T A 13: 65,035,613 L323* probably null Het
Supt16 C T 14: 52,173,589 G686D probably damaging Het
Szt2 C T 4: 118,372,681 R2751H unknown Het
Tnfsf8 A G 4: 63,837,100 L95P probably damaging Het
Vmn2r17 A G 5: 109,429,562 H493R probably benign Het
Zfp770 C T 2: 114,196,770 A273T possibly damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CGGAAGTTTTAAGAGCCAGC -3'
(R):5'- GGCTGCTACTGTCTCCAAAC -3'

Sequencing Primer
(F):5'- AGTTTTAAGAGCCAGCTTCAGG -3'
(R):5'- TGCTACTGTCTCCAAACTCTGAAAAC -3'
Posted On2015-09-25