Mutagenetix > Incidental Mutation

Incidental Mutation 'R4597:Fga'

344424

Institutional Source

Beutler Lab

Gene Symbol

Fga

Ensembl Gene

ENSMUSG00000028001

Gene Name

fibrinogen alpha chain

Synonyms

ENSMUSG00000059807, Fib

MMRRC Submission

041813-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.294) question?

Stock #

R4597 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83026076-83033627 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 83031235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 306 (G306*)

Ref Sequence

ENSEMBL: ENSMUSP00000133117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]

AlphaFold

E9PV24

Predicted Effect

probably null
Transcript: ENSMUST00000029630
AA Change: G306*

SMART Domains

Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: G306*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	458	1.6e-33	PFAM
low complexity region	500	522	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166581
AA Change: G306*

SMART Domains

Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: G306*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	457	9.3e-34	PFAM
low complexity region	500	522	N/A	INTRINSIC
FBG	550	786	1.43e-128	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
4931422A03Rik	T	A	2: 104,026,155		probably benign	Het
Adh5	T	C	3: 138,445,357	V27A	probably damaging	Het
Ank2	A	T	3: 126,988,151	D843E	probably damaging	Het
Arid2	A	G	15: 96,370,856	N950S	probably damaging	Het
Arl1	A	T	10: 88,730,746		probably benign	Het
Bcl3	T	G	7: 19,812,503	I136L	probably damaging	Het
C130060K24Rik	T	C	6: 65,447,424		probably null	Het
Car9	T	A	4: 43,509,138	S235R	probably damaging	Het
Carnmt1	G	T	19: 18,671,087	G30W	probably damaging	Het
Casp12	C	T	9: 5,348,941	T101I	possibly damaging	Het
Cdh23	A	G	10: 60,409,044	L1026P	probably damaging	Het
Clec10a	A	T	11: 70,169,980	Y186F	probably damaging	Het
Col22a1	G	T	15: 71,964,662	A508E	possibly damaging	Het
Crocc	G	C	4: 141,019,777	S1573R	probably damaging	Het
Cttnbp2nl	G	T	3: 105,005,875	T231K	possibly damaging	Het
Drd4	T	C	7: 141,294,479	V319A	probably damaging	Het
Ehbp1l1	T	C	19: 5,717,927	E1116G	possibly damaging	Het
Fam83d	T	C	2: 158,785,222	V277A	possibly damaging	Het
Fkbp9	A	G	6: 56,832,382	Y59C	probably damaging	Het
Frmpd1	A	G	4: 45,274,441	T450A	probably benign	Het
Gabbr1	A	G	17: 37,056,899	M414V	possibly damaging	Het
Gm15448	T	A	7: 3,822,155	Y496F	possibly damaging	Het
Gm16506	A	G	14: 43,725,115	F112L	unknown	Het
Gm27047	T	C	6: 130,630,336		noncoding transcript	Het
Gm4353	T	A	7: 116,083,612	K245*	probably null	Het
Gm4950	A	T	18: 51,865,793	I30N	probably benign	Het
Gm8298	T	A	3: 59,876,793	M229K	possibly damaging	Het
H2-M10.2	T	C	17: 36,285,393	T187A	probably benign	Het
H60c	A	T	10: 3,259,968	N106K	possibly damaging	Het
Hist1h1b	A	T	13: 21,780,511	V15E	probably damaging	Het
Hoxa6	T	C	6: 52,208,407		probably null	Het
Ighv1-74	A	G	12: 115,802,656	C115R	probably damaging	Het
Il17a	G	A	1: 20,730,993		probably null	Het
Itga9	T	C	9: 118,843,514	Y199H	probably damaging	Het
Itpr3	C	T	17: 27,093,283	R554C	probably damaging	Het
Kcnc3	T	A	7: 44,595,816	M510K	probably damaging	Het
Kif15	A	G	9: 122,993,849	T432A	probably benign	Het
Kif26b	A	T	1: 178,916,793	S1485C	probably damaging	Het
Klhl2	C	A	8: 64,754,387	G313W	probably damaging	Het
Klhl32	C	T	4: 24,629,339	S476N	probably benign	Het
Krt1	C	T	15: 101,847,628	E386K	possibly damaging	Het
Lats1	T	C	10: 7,691,746	S94P	probably benign	Het
Ltf	G	A	9: 111,022,933	C146Y	probably damaging	Het
Mars	A	G	10: 127,300,453	L501P	probably damaging	Het
Myh2	A	C	11: 67,189,418	I1153L	probably benign	Het
Ncstn	A	T	1: 172,068,256	Y522*	probably null	Het
Nipal4	A	G	11: 46,151,329	V175A	probably damaging	Het
Olfr860	T	C	9: 19,845,691	I309M	probably benign	Het
Pcdha1	C	G	18: 36,931,906	A541G	possibly damaging	Het
Pex11g	A	G	8: 3,464,043	Y40H	probably damaging	Het
Rin2	G	T	2: 145,860,905	R507L	probably benign	Het
Sh2b2	T	C	5: 136,231,762	D200G	probably damaging	Het
Smg7	C	A	1: 152,840,301		probably null	Het
Snx17	T	C	5: 31,198,513		probably benign	Het
Sos1	T	C	17: 80,433,826	Y510C	probably benign	Het
Spata31d1c	T	A	13: 65,035,613	L323*	probably null	Het
Supt16	C	T	14: 52,173,589	G686D	probably damaging	Het
Szt2	C	T	4: 118,372,681	R2751H	unknown	Het
Tnfsf8	A	G	4: 63,837,100	L95P	probably damaging	Het
Vmn2r17	A	G	5: 109,429,562	H493R	probably benign	Het
Zfp770	C	T	2: 114,196,770	A273T	possibly damaging	Het

Other mutations in Fga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Fga	APN	3	83031674	missense	probably damaging	1.00
IGL00478:Fga	APN	3	83028644	missense	probably benign	0.00
IGL00587:Fga	APN	3	83030289	missense	possibly damaging	0.62
IGL01289:Fga	APN	3	83031245	missense	possibly damaging	0.85
IGL01323:Fga	APN	3	83030211	missense	probably damaging	0.99
IGL01369:Fga	APN	3	83030200	missense	probably benign	0.00
IGL01409:Fga	APN	3	83032752	missense	probably damaging	1.00
IGL01541:Fga	APN	3	83032707	missense	probably damaging	1.00
IGL01633:Fga	APN	3	83030299	missense	possibly damaging	0.89
IGL01966:Fga	APN	3	83029154	missense	probably damaging	0.97
IGL02651:Fga	APN	3	83028534	missense	probably benign	0.00
IGL02822:Fga	APN	3	83031482	missense	probably damaging	1.00
IGL03003:Fga	APN	3	83032730	missense	probably damaging	1.00
R0336:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R0540:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R0607:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R1471:Fga	UTSW	3	83028618	missense	probably benign	0.16
R1517:Fga	UTSW	3	83031838	missense	probably benign	0.00
R1817:Fga	UTSW	3	83031775	missense	probably benign	0.00
R1874:Fga	UTSW	3	83032721	missense	probably damaging	1.00
R2014:Fga	UTSW	3	83032757	missense	probably damaging	0.99
R2267:Fga	UTSW	3	83032950	missense	probably damaging	1.00
R2332:Fga	UTSW	3	83031397	missense	probably damaging	1.00
R2420:Fga	UTSW	3	83033154	missense	possibly damaging	0.53
R2443:Fga	UTSW	3	83028541	missense	probably benign	0.03
R3978:Fga	UTSW	3	83030183	critical splice acceptor site	probably null
R4644:Fga	UTSW	3	83030266	missense	possibly damaging	0.81
R4760:Fga	UTSW	3	83031514	missense	probably benign
R4867:Fga	UTSW	3	83028644	missense	probably benign	0.00
R5449:Fga	UTSW	3	83030862	frame shift	probably null
R5507:Fga	UTSW	3	83033336	missense	probably damaging	1.00
R5712:Fga	UTSW	3	83033133	missense	possibly damaging	0.70
R6853:Fga	UTSW	3	83030912	missense	probably damaging	1.00
R6865:Fga	UTSW	3	83031541	missense	probably damaging	1.00
R7163:Fga	UTSW	3	83026264	missense	probably benign	0.04
R7724:Fga	UTSW	3	83029125	missense	probably damaging	0.99
R8153:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R8506:Fga	UTSW	3	83033316	missense	probably damaging	1.00
R8511:Fga	UTSW	3	83031757	nonsense	probably null
R8523:Fga	UTSW	3	83030851	missense	probably damaging	1.00
R8801:Fga	UTSW	3	83030881	missense	possibly damaging	0.89
R8906:Fga	UTSW	3	83031804	missense	probably benign	0.12
R9390:Fga	UTSW	3	83033303	missense	probably damaging	1.00
R9609:Fga	UTSW	3	83032757	missense	probably damaging	1.00
X0062:Fga	UTSW	3	83030271	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CGGAAGTTTTAAGAGCCAGC -3'
(R):5'- GGCTGCTACTGTCTCCAAAC -3'

Sequencing Primer
(F):5'- AGTTTTAAGAGCCAGCTTCAGG -3'
(R):5'- TGCTACTGTCTCCAAACTCTGAAAAC -3'

Posted On

2015-09-25