Mutagenetix > Incidental Mutation

Incidental Mutation 'R4597:Szt2'

344432

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

041813-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R4597 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 118372681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 2751 (R2751H)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000075406
AA Change: R2751H

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: R2751H

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138632

Predicted Effect

unknown
Transcript: ENSMUST00000183402
AA Change: R282H

Meta Mutation Damage Score

0.1819

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
4931422A03Rik	T	A	2: 104,026,155		probably benign	Het
Adh5	T	C	3: 138,445,357	V27A	probably damaging	Het
Ank2	A	T	3: 126,988,151	D843E	probably damaging	Het
Arid2	A	G	15: 96,370,856	N950S	probably damaging	Het
Arl1	A	T	10: 88,730,746		probably benign	Het
Bcl3	T	G	7: 19,812,503	I136L	probably damaging	Het
C130060K24Rik	T	C	6: 65,447,424		probably null	Het
Car9	T	A	4: 43,509,138	S235R	probably damaging	Het
Carnmt1	G	T	19: 18,671,087	G30W	probably damaging	Het
Casp12	C	T	9: 5,348,941	T101I	possibly damaging	Het
Cdh23	A	G	10: 60,409,044	L1026P	probably damaging	Het
Clec10a	A	T	11: 70,169,980	Y186F	probably damaging	Het
Col22a1	G	T	15: 71,964,662	A508E	possibly damaging	Het
Crocc	G	C	4: 141,019,777	S1573R	probably damaging	Het
Cttnbp2nl	G	T	3: 105,005,875	T231K	possibly damaging	Het
Drd4	T	C	7: 141,294,479	V319A	probably damaging	Het
Ehbp1l1	T	C	19: 5,717,927	E1116G	possibly damaging	Het
Fam83d	T	C	2: 158,785,222	V277A	possibly damaging	Het
Fga	G	T	3: 83,031,235	G306*	probably null	Het
Fkbp9	A	G	6: 56,832,382	Y59C	probably damaging	Het
Frmpd1	A	G	4: 45,274,441	T450A	probably benign	Het
Gabbr1	A	G	17: 37,056,899	M414V	possibly damaging	Het
Gm15448	T	A	7: 3,822,155	Y496F	possibly damaging	Het
Gm16506	A	G	14: 43,725,115	F112L	unknown	Het
Gm27047	T	C	6: 130,630,336		noncoding transcript	Het
Gm4353	T	A	7: 116,083,612	K245*	probably null	Het
Gm4950	A	T	18: 51,865,793	I30N	probably benign	Het
Gm8298	T	A	3: 59,876,793	M229K	possibly damaging	Het
H2-M10.2	T	C	17: 36,285,393	T187A	probably benign	Het
H60c	A	T	10: 3,259,968	N106K	possibly damaging	Het
Hist1h1b	A	T	13: 21,780,511	V15E	probably damaging	Het
Hoxa6	T	C	6: 52,208,407		probably null	Het
Ighv1-74	A	G	12: 115,802,656	C115R	probably damaging	Het
Il17a	G	A	1: 20,730,993		probably null	Het
Itga9	T	C	9: 118,843,514	Y199H	probably damaging	Het
Itpr3	C	T	17: 27,093,283	R554C	probably damaging	Het
Kcnc3	T	A	7: 44,595,816	M510K	probably damaging	Het
Kif15	A	G	9: 122,993,849	T432A	probably benign	Het
Kif26b	A	T	1: 178,916,793	S1485C	probably damaging	Het
Klhl2	C	A	8: 64,754,387	G313W	probably damaging	Het
Klhl32	C	T	4: 24,629,339	S476N	probably benign	Het
Krt1	C	T	15: 101,847,628	E386K	possibly damaging	Het
Lats1	T	C	10: 7,691,746	S94P	probably benign	Het
Ltf	G	A	9: 111,022,933	C146Y	probably damaging	Het
Mars	A	G	10: 127,300,453	L501P	probably damaging	Het
Myh2	A	C	11: 67,189,418	I1153L	probably benign	Het
Ncstn	A	T	1: 172,068,256	Y522*	probably null	Het
Nipal4	A	G	11: 46,151,329	V175A	probably damaging	Het
Olfr860	T	C	9: 19,845,691	I309M	probably benign	Het
Pcdha1	C	G	18: 36,931,906	A541G	possibly damaging	Het
Pex11g	A	G	8: 3,464,043	Y40H	probably damaging	Het
Rin2	G	T	2: 145,860,905	R507L	probably benign	Het
Sh2b2	T	C	5: 136,231,762	D200G	probably damaging	Het
Smg7	C	A	1: 152,840,301		probably null	Het
Snx17	T	C	5: 31,198,513		probably benign	Het
Sos1	T	C	17: 80,433,826	Y510C	probably benign	Het
Spata31d1c	T	A	13: 65,035,613	L323*	probably null	Het
Supt16	C	T	14: 52,173,589	G686D	probably damaging	Het
Tnfsf8	A	G	4: 63,837,100	L95P	probably damaging	Het
Vmn2r17	A	G	5: 109,429,562	H493R	probably benign	Het
Zfp770	C	T	2: 114,196,770	A273T	possibly damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCACACTCAGGTCTTCGC -3'
(R):5'- ATAGCTCTGGCCACTGAGTG -3'

Sequencing Primer
(F):5'- GCTGCCTGGCCCACATTC -3'
(R):5'- CACTGAGTGGCCAGCTAAAG -3'

Posted On

2015-09-25