Incidental Mutation 'R4609:Clasp1'
ID344488
Institutional Source Beutler Lab
Gene Symbol Clasp1
Ensembl Gene ENSMUSG00000064302
Gene NameCLIP associating protein 1
Synonyms1700030C23Rik, B130045P17Rik, CLASP1, mCLASP1, 5730583A19Rik, CLASP1alpha
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location118389058-118612678 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 118503035 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000049404] [ENSMUST00000070989] [ENSMUST00000165223] [ENSMUST00000178710] [ENSMUST00000185405] [ENSMUST00000186349] [ENSMUST00000187713] [ENSMUST00000188710] [ENSMUST00000189262] [ENSMUST00000189570] [ENSMUST00000189738] [ENSMUST00000190571] [ENSMUST00000190733] [ENSMUST00000191445] [ENSMUST00000191823]
Predicted Effect probably benign
Transcript: ENSMUST00000049404
SMART Domains Protein: ENSMUSP00000042266
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070989
SMART Domains Protein: ENSMUSP00000067858
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 3.23e-1 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165223
SMART Domains Protein: ENSMUSP00000128089
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1056 3.23e-1 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178710
SMART Domains Protein: ENSMUSP00000137137
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1047 6.55e-2 SMART
low complexity region 1058 1075 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
TOG 1210 1448 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185405
SMART Domains Protein: ENSMUSP00000139619
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 769 783 N/A INTRINSIC
low complexity region 801 811 N/A INTRINSIC
TOG 827 1065 1.6e-5 SMART
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1166 1177 N/A INTRINSIC
TOG 1228 1466 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186349
SMART Domains Protein: ENSMUSP00000141105
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187713
SMART Domains Protein: ENSMUSP00000139526
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 768 782 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
TOG 826 1064 1.6e-5 SMART
low complexity region 1075 1092 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
TOG 1227 1465 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188710
SMART Domains Protein: ENSMUSP00000140593
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 818 832 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 1.6e-5 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189262
SMART Domains Protein: ENSMUSP00000140860
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
TOG 802 1040 1.6e-5 SMART
low complexity region 1051 1068 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
TOG 1203 1441 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189570
SMART Domains Protein: ENSMUSP00000140167
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1055 3.2e-6 SMART
low complexity region 1066 1083 N/A INTRINSIC
low complexity region 1156 1167 N/A INTRINSIC
TOG 1218 1456 2.3e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189676
Predicted Effect probably benign
Transcript: ENSMUST00000189738
SMART Domains Protein: ENSMUSP00000140665
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1048 3.23e-1 SMART
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
TOG 1211 1449 4.96e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190135
Predicted Effect probably benign
Transcript: ENSMUST00000190571
SMART Domains Protein: ENSMUSP00000140019
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
low complexity region 805 819 N/A INTRINSIC
low complexity region 837 847 N/A INTRINSIC
TOG 863 1101 1.6e-5 SMART
low complexity region 1112 1129 N/A INTRINSIC
low complexity region 1150 1163 N/A INTRINSIC
low complexity region 1241 1252 N/A INTRINSIC
TOG 1303 1541 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190733
Predicted Effect probably benign
Transcript: ENSMUST00000191445
SMART Domains Protein: ENSMUSP00000140095
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 761 775 N/A INTRINSIC
low complexity region 793 803 N/A INTRINSIC
TOG 819 1056 3.2e-6 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191823
SMART Domains Protein: ENSMUSP00000142203
Gene: ENSMUSG00000064302

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
TOG 87 319 5.6e-16 SMART
low complexity region 347 362 N/A INTRINSIC
low complexity region 374 401 N/A INTRINSIC
low complexity region 450 483 N/A INTRINSIC
low complexity region 537 551 N/A INTRINSIC
low complexity region 568 578 N/A INTRINSIC
TOG 594 832 1.6e-5 SMART
low complexity region 843 860 N/A INTRINSIC
low complexity region 933 944 N/A INTRINSIC
TOG 995 1233 2.4e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204886
Predicted Effect probably benign
Transcript: ENSMUST00000204904
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Clasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01786:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01871:Clasp1 APN 1 118570889 missense probably damaging 1.00
IGL02066:Clasp1 APN 1 118565260 critical splice donor site probably null
IGL02602:Clasp1 APN 1 118471785 missense probably damaging 0.99
IGL02683:Clasp1 APN 1 118539266 missense probably benign 0.33
IGL02728:Clasp1 APN 1 118602377 missense probably damaging 1.00
IGL02820:Clasp1 APN 1 118551104 missense possibly damaging 0.77
IGL02874:Clasp1 APN 1 118552043 missense possibly damaging 0.86
IGL02975:Clasp1 APN 1 118462547 missense probably damaging 1.00
IGL03100:Clasp1 APN 1 118467896 missense possibly damaging 0.79
IGL03115:Clasp1 APN 1 118501323 nonsense probably null
IGL03122:Clasp1 APN 1 118510277 missense probably damaging 1.00
IGL03180:Clasp1 APN 1 118505525 missense probably benign 0.33
IGL03248:Clasp1 APN 1 118602476 missense probably benign 0.01
IGL03388:Clasp1 APN 1 118505503 missense possibly damaging 0.95
F5770:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
I2288:Clasp1 UTSW 1 118565229 missense probably benign 0.09
PIT4585001:Clasp1 UTSW 1 118462555 missense probably damaging 0.99
R0079:Clasp1 UTSW 1 118543304 missense probably damaging 1.00
R0395:Clasp1 UTSW 1 118539331 missense possibly damaging 0.48
R0960:Clasp1 UTSW 1 118552026 missense probably benign 0.39
R1448:Clasp1 UTSW 1 118508916 missense probably benign 0.01
R1497:Clasp1 UTSW 1 118552058 missense probably benign 0.42
R1607:Clasp1 UTSW 1 118504959 missense probably damaging 0.98
R1722:Clasp1 UTSW 1 118590464 missense probably damaging 1.00
R1758:Clasp1 UTSW 1 118548025 missense probably damaging 1.00
R1765:Clasp1 UTSW 1 118505531 missense probably damaging 0.99
R1855:Clasp1 UTSW 1 118508894 missense probably damaging 1.00
R1861:Clasp1 UTSW 1 118570931 missense possibly damaging 0.93
R1874:Clasp1 UTSW 1 118600585 critical splice donor site probably null
R1942:Clasp1 UTSW 1 118501348 missense possibly damaging 0.94
R2025:Clasp1 UTSW 1 118504899 missense probably damaging 1.00
R2174:Clasp1 UTSW 1 118560095 missense probably damaging 1.00
R2280:Clasp1 UTSW 1 118565183 missense probably benign 0.05
R2288:Clasp1 UTSW 1 118578878 missense probably benign
R2895:Clasp1 UTSW 1 118459838 missense probably damaging 1.00
R3958:Clasp1 UTSW 1 118467881 missense probably damaging 0.99
R4073:Clasp1 UTSW 1 118503848 missense probably damaging 1.00
R4206:Clasp1 UTSW 1 118578906 missense probably damaging 1.00
R4465:Clasp1 UTSW 1 118561078 missense probably damaging 1.00
R4679:Clasp1 UTSW 1 118543271 missense probably damaging 0.99
R4707:Clasp1 UTSW 1 118543197 nonsense probably null
R4809:Clasp1 UTSW 1 118461250 missense probably benign 0.00
R4906:Clasp1 UTSW 1 118508910 nonsense probably null
R5048:Clasp1 UTSW 1 118547610 intron probably benign
R5298:Clasp1 UTSW 1 118547920 missense possibly damaging 0.71
R5485:Clasp1 UTSW 1 118467913 missense possibly damaging 0.95
R5516:Clasp1 UTSW 1 118497721 missense probably damaging 1.00
R5821:Clasp1 UTSW 1 118590484 missense probably damaging 1.00
R5911:Clasp1 UTSW 1 118506908 unclassified probably benign
R6092:Clasp1 UTSW 1 118510298 missense probably damaging 0.97
R6181:Clasp1 UTSW 1 118419817 missense probably benign 0.18
R6478:Clasp1 UTSW 1 118512180 nonsense probably null
R7090:Clasp1 UTSW 1 118482086 missense probably benign 0.45
R7216:Clasp1 UTSW 1 118547918 missense probably benign 0.00
R7508:Clasp1 UTSW 1 118545434 missense probably benign 0.30
R7541:Clasp1 UTSW 1 118542997 intron probably null
R7910:Clasp1 UTSW 1 118602414 nonsense probably null
R7991:Clasp1 UTSW 1 118602414 nonsense probably null
V7581:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
X0028:Clasp1 UTSW 1 118551125 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGATCGTTACTCTTGGCTGG -3'
(R):5'- CCACCAGAACATTAAGTGTGC -3'

Sequencing Primer
(F):5'- CTGGGGCTGCTGAGTACGATAAC -3'
(R):5'- GCACTCTATCCTGTAAGCAAAAATC -3'
Posted On2015-09-25