Incidental Mutation 'R4609:Ube2e3'
ID344493
Institutional Source Beutler Lab
Gene Symbol Ube2e3
Ensembl Gene ENSMUSG00000027011
Gene Nameubiquitin-conjugating enzyme E2E 3
SynonymsubcM2, Ubce4
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location78868124-78921293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78918712 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 135 (H135R)
Ref Sequence ENSEMBL: ENSMUSP00000113463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028398] [ENSMUST00000121433] [ENSMUST00000130914]
Predicted Effect probably damaging
Transcript: ENSMUST00000028398
AA Change: H135R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028398
Gene: ENSMUSG00000027011
AA Change: H135R

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
UBCc 64 207 3.91e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121433
AA Change: H135R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113463
Gene: ENSMUSG00000027011
AA Change: H135R

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
UBCc 64 207 3.91e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130914
SMART Domains Protein: ENSMUSP00000116644
Gene: ENSMUSG00000027011

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
SCOP:d2e2c__ 55 104 6e-18 SMART
Blast:UBCc 65 104 3e-22 BLAST
PDB:1Y6L|C 65 104 8e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153614
Meta Mutation Damage Score 0.9695 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse and rat counterparts, which indicates that this enzyme is highly conserved in eukaryotes. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Ube2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02619:Ube2e3 APN 2 78918721 missense probably damaging 1.00
R0069:Ube2e3 UTSW 2 78919949 splice site probably benign
R0069:Ube2e3 UTSW 2 78919949 splice site probably benign
R0586:Ube2e3 UTSW 2 78919990 missense probably benign 0.41
R6918:Ube2e3 UTSW 2 78920039 missense probably damaging 1.00
R7136:Ube2e3 UTSW 2 78913741 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGTTCACTTTGTTCTTAAACCAGGG -3'
(R):5'- TCTGATGCAGCTCTTCCTAATAG -3'

Sequencing Primer
(F):5'- AGTGCATGCTGATAGTCCCAGTAC -3'
(R):5'- ACCAGGGTTGCAATCTGT -3'
Posted On2015-09-25