Mutagenetix > Incidental Mutations

Incidental Mutation 'R4609:Wdr19'

344503

Institutional Source

Beutler Lab

Gene Symbol

Wdr19

Ensembl Gene

ENSMUSG00000037890

Gene Name

WD repeat domain 19

Synonyms

MMRRC Submission

041820-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4609 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65199696-65260415 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65228542 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 622 (T622A)

Ref Sequence

ENSEMBL: ENSMUSP00000144866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041892
AA Change: T622A

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890
AA Change: T622A

Domain	Start	End	E-Value	Type
WD40	6	42	4.26e1	SMART
WD40	44	83	2.13e1	SMART
WD40	85	125	2.75e1	SMART
WD40	128	166	2.67e-1	SMART
Blast:WD40	220	258	6e-9	BLAST
WD40	264	302	1.46e-1	SMART
Blast:WD40	308	347	2e-18	BLAST
Pfam:WD40_3	508	564	2.7e-32	PFAM
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1259	1268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203359

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203653
AA Change: T622A

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890
AA Change: T622A

Domain	Start	End	E-Value	Type
WD40	6	42	4.26e1	SMART
WD40	44	83	2.13e1	SMART
WD40	85	125	2.75e1	SMART
WD40	128	166	2.67e-1	SMART
Blast:WD40	220	258	6e-9	BLAST
WD40	264	302	1.46e-1	SMART
Blast:WD40	308	347	2e-18	BLAST
Pfam:WD40_3	508	564	2.7e-32	PFAM
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1259	1268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203676

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204375

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204647

Meta Mutation Damage Score

0.1437

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7530416G11Rik	T	C	15: 85,494,169	D91G	unknown	Het
Adam10	T	C	9: 70,740,143	Y42H	probably damaging	Het
Baiap3	A	T	17: 25,250,261	C183S	probably damaging	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Bmp1	C	T	14: 70,477,966	V910M	probably benign	Het
Brdt	G	A	5: 107,359,936	A677T	probably benign	Het
Cadps2	A	T	6: 23,587,579	M304K	probably damaging	Het
Car9	A	T	4: 43,507,267	D71V	possibly damaging	Het
Chml	A	T	1: 175,687,157	Y399*	probably null	Het
Clasp1	A	G	1: 118,503,035		probably benign	Het
Cntnap5b	G	A	1: 99,772,847		probably null	Het
Cpvl	A	T	6: 53,974,620		probably null	Het
Crocc2	G	A	1: 93,168,794	V24M	possibly damaging	Het
Cxcl16	T	C	11: 70,455,429	Y226C	probably damaging	Het
Dio3	G	T	12: 110,280,010	R260L	probably damaging	Het
Dmxl2	A	G	9: 54,446,512	L724P	probably damaging	Het
Dnah7a	A	C	1: 53,456,657	F3214V	possibly damaging	Het
Dpy19l4	A	T	4: 11,295,999	Y223*	probably null	Het
Dpysl4	T	C	7: 139,098,621	V499A	probably damaging	Het
Ets2	A	T	16: 95,711,774	K101N	probably benign	Het
Fam160a2	A	G	7: 105,388,224	I384T	probably damaging	Het
Fbn2	A	T	18: 58,190,269	Y200*	probably null	Het
Fem1c	A	T	18: 46,505,948	I329N	probably damaging	Het
Gm8919	T	C	3: 11,659,470		noncoding transcript	Het
H2-Q5	A	T	17: 35,397,080	H206L	probably benign	Het
Hexa	T	C	9: 59,557,319	F164S	probably benign	Het
Hk1	G	T	10: 62,358,415		probably benign	Het
Ick	T	A	9: 78,167,789		probably benign	Het
Itih4	G	A	14: 30,901,669	G915R	probably damaging	Het
Kcnq5	A	T	1: 21,405,068		probably null	Het
Krtap10-4	A	T	10: 77,826,796		probably benign	Het
Maml3	G	T	3: 51,855,592	H650Q	probably damaging	Het
Mief1	C	A	15: 80,248,253	P112Q	probably benign	Het
Morc3	A	G	16: 93,864,968	E472G	probably benign	Het
Nap1l1	T	A	10: 111,492,880	Y223*	probably null	Het
Nfix	A	T	8: 84,726,490	W312R	probably damaging	Het
Nfkbie	A	T	17: 45,558,584	N155I	probably damaging	Het
Nlgn2	A	T	11: 69,834,086	M118K	probably damaging	Het
Nlrp5	A	T	7: 23,417,748	Y299F	probably benign	Het
Nnt	T	C	13: 119,357,536	I556V	possibly damaging	Het
Oasl2	A	T	5: 114,899,796	I85F	possibly damaging	Het
Ogg1	A	C	6: 113,328,432	T69P	probably damaging	Het
Olfml2a	G	T	2: 38,957,721	V431L	probably damaging	Het
Olfr507	A	T	7: 108,622,504	M231L	probably benign	Het
Olfr984	T	C	9: 40,100,806	H228R	possibly damaging	Het
Palb2	G	T	7: 122,124,723	A601E	probably benign	Het
Pcdhb20	G	A	18: 37,505,796	M458I	probably benign	Het
Pde11a	T	C	2: 76,291,241	D332G	possibly damaging	Het
Pkd1l1	C	T	11: 8,958,964	E347K	unknown	Het
Pou2af1	G	A	9: 51,238,225	V206I	possibly damaging	Het
Prr16	A	G	18: 51,118,067	D46G	possibly damaging	Het
Pus1	A	G	5: 110,780,318	M1T	probably null	Het
Pygm	T	A	19: 6,391,409	V566D	possibly damaging	Het
Rb1	T	A	14: 73,262,514		probably benign	Het
Rhoj	A	T	12: 75,400,206	K200*	probably null	Het
Rnf213	A	G	11: 119,437,695	I1985V	possibly damaging	Het
Sept11	G	T	5: 93,162,254	M305I	possibly damaging	Het
Setdb2	T	C	14: 59,415,704	Y383C	probably damaging	Het
Sfpq	G	C	4: 127,021,611	Q65H	unknown	Het
Stard3nl	G	T	13: 19,370,264	A180E	probably damaging	Het
Tanc2	A	G	11: 105,910,240	N1094S	probably benign	Het
Trf	C	T	9: 103,211,985	A554T	possibly damaging	Het
Trmt13	T	C	3: 116,594,827		probably benign	Het
Tubb3	A	G	8: 123,420,919	D197G	probably damaging	Het
Ube2e3	A	G	2: 78,918,712	H135R	probably damaging	Het
Ugt1a10	A	T	1: 88,055,482	M1L	possibly damaging	Het
Vmn1r233	A	T	17: 20,994,415	I91N	possibly damaging	Het
Vmn2r88	A	T	14: 51,418,074	D580V	probably damaging	Het
Vps33b	A	G	7: 80,291,118	Y593C	probably benign	Het
Wdr3	C	T	3: 100,140,200	R853Q	probably damaging	Het
Wdr61	A	G	9: 54,728,179	V46A	probably benign	Het
Xirp1	T	C	9: 120,016,506	T1104A	probably benign	Het
Yipf1	G	A	4: 107,344,683		probably null	Het
Zbtb17	A	G	4: 141,466,498	D651G	probably damaging	Het
Zbtb42	C	T	12: 112,680,542	R384W	probably damaging	Het
Zbtb43	A	T	2: 33,454,043	M390K	probably benign	Het
Zfp462	C	T	4: 55,011,889	T1285M	probably damaging	Het

Other mutations in Wdr19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Wdr19	APN	5	65252299	missense	probably benign	0.41
IGL01346:Wdr19	APN	5	65221739	splice site	probably benign
IGL01761:Wdr19	APN	5	65215820	missense	possibly damaging	0.60
IGL01845:Wdr19	APN	5	65225366	missense	probably damaging	0.98
IGL01977:Wdr19	APN	5	65228569	missense	probably benign
IGL02314:Wdr19	APN	5	65257120	missense	probably benign	0.26
IGL02455:Wdr19	APN	5	65224759	missense	probably benign	0.01
IGL02542:Wdr19	APN	5	65231071	missense	probably benign
IGL02616:Wdr19	APN	5	65223581	missense	probably damaging	0.97
IGL02661:Wdr19	APN	5	65245808	missense	probably benign	0.06
IGL02927:Wdr19	APN	5	65252378	missense	possibly damaging	0.80
IGL02958:Wdr19	APN	5	65212807	splice site	probably null
IGL03083:Wdr19	APN	5	65230976	missense	probably benign	0.01
IGL03332:Wdr19	APN	5	65227143	missense	possibly damaging	0.89
detritus	UTSW	5	65212891	missense	possibly damaging	0.59
refuse	UTSW	5	65228292	missense	possibly damaging	0.64
R0924:Wdr19	UTSW	5	65256439	splice site	probably benign
R1178:Wdr19	UTSW	5	65223865	missense	probably damaging	0.98
R1229:Wdr19	UTSW	5	65256391	missense	possibly damaging	0.94
R1434:Wdr19	UTSW	5	65223504	splice site	probably benign
R1543:Wdr19	UTSW	5	65224690	missense	probably benign	0.06
R1819:Wdr19	UTSW	5	65212891	missense	possibly damaging	0.59
R1971:Wdr19	UTSW	5	65241160	splice site	probably benign
R2190:Wdr19	UTSW	5	65244166	missense	possibly damaging	0.89
R2274:Wdr19	UTSW	5	65240991	missense	possibly damaging	0.62
R3106:Wdr19	UTSW	5	65202623	missense	probably benign	0.20
R3753:Wdr19	UTSW	5	65224726	missense	probably damaging	1.00
R3893:Wdr19	UTSW	5	65228292	missense	possibly damaging	0.64
R5284:Wdr19	UTSW	5	65225409	missense	probably damaging	1.00
R5328:Wdr19	UTSW	5	65244179	missense	probably damaging	1.00
R5530:Wdr19	UTSW	5	65228219	missense	probably benign
R5837:Wdr19	UTSW	5	65202957	missense	probably benign	0.08
R5902:Wdr19	UTSW	5	65227139	missense	probably benign	0.09
R6065:Wdr19	UTSW	5	65221713	missense	probably benign
R6419:Wdr19	UTSW	5	65215893	missense	possibly damaging	0.63
R6495:Wdr19	UTSW	5	65258123	missense	probably benign	0.00
R6916:Wdr19	UTSW	5	65225334	missense	possibly damaging	0.64
R7020:Wdr19	UTSW	5	65256314	missense	probably damaging	0.99
R7190:Wdr19	UTSW	5	65240862	missense	probably benign	0.35
X0028:Wdr19	UTSW	5	65244144	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATCCAAGGTACCAGTCACG -3'
(R):5'- CAAGCTGTGTCTATCTACCGG -3'

Sequencing Primer
(F):5'- CTGAAAAATGCATCTCCATTGCAGTG -3'
(R):5'- CTATCTACCGGATAGGCCATGAAG -3'

Posted On

2015-09-25