Mutagenetix > Incidental Mutations

Incidental Mutation 'R4609:Brdt'

344505

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

041820-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4609 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 107359936 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 677 (A677T)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000031215
AA Change: A677T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: A677T

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162804

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7530416G11Rik	T	C	15: 85,494,169	D91G	unknown	Het
Adam10	T	C	9: 70,740,143	Y42H	probably damaging	Het
Baiap3	A	T	17: 25,250,261	C183S	probably damaging	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Bmp1	C	T	14: 70,477,966	V910M	probably benign	Het
Cadps2	A	T	6: 23,587,579	M304K	probably damaging	Het
Car9	A	T	4: 43,507,267	D71V	possibly damaging	Het
Chml	A	T	1: 175,687,157	Y399*	probably null	Het
Clasp1	A	G	1: 118,503,035		probably benign	Het
Cntnap5b	G	A	1: 99,772,847		probably null	Het
Cpvl	A	T	6: 53,974,620		probably null	Het
Crocc2	G	A	1: 93,168,794	V24M	possibly damaging	Het
Cxcl16	T	C	11: 70,455,429	Y226C	probably damaging	Het
Dio3	G	T	12: 110,280,010	R260L	probably damaging	Het
Dmxl2	A	G	9: 54,446,512	L724P	probably damaging	Het
Dnah7a	A	C	1: 53,456,657	F3214V	possibly damaging	Het
Dpy19l4	A	T	4: 11,295,999	Y223*	probably null	Het
Dpysl4	T	C	7: 139,098,621	V499A	probably damaging	Het
Ets2	A	T	16: 95,711,774	K101N	probably benign	Het
Fam160a2	A	G	7: 105,388,224	I384T	probably damaging	Het
Fbn2	A	T	18: 58,190,269	Y200*	probably null	Het
Fem1c	A	T	18: 46,505,948	I329N	probably damaging	Het
Gm8919	T	C	3: 11,659,470		noncoding transcript	Het
H2-Q5	A	T	17: 35,397,080	H206L	probably benign	Het
Hexa	T	C	9: 59,557,319	F164S	probably benign	Het
Hk1	G	T	10: 62,358,415		probably benign	Het
Ick	T	A	9: 78,167,789		probably benign	Het
Itih4	G	A	14: 30,901,669	G915R	probably damaging	Het
Kcnq5	A	T	1: 21,405,068		probably null	Het
Krtap10-4	A	T	10: 77,826,796		probably benign	Het
Maml3	G	T	3: 51,855,592	H650Q	probably damaging	Het
Mief1	C	A	15: 80,248,253	P112Q	probably benign	Het
Morc3	A	G	16: 93,864,968	E472G	probably benign	Het
Nap1l1	T	A	10: 111,492,880	Y223*	probably null	Het
Nfix	A	T	8: 84,726,490	W312R	probably damaging	Het
Nfkbie	A	T	17: 45,558,584	N155I	probably damaging	Het
Nlgn2	A	T	11: 69,834,086	M118K	probably damaging	Het
Nlrp5	A	T	7: 23,417,748	Y299F	probably benign	Het
Nnt	T	C	13: 119,357,536	I556V	possibly damaging	Het
Oasl2	A	T	5: 114,899,796	I85F	possibly damaging	Het
Ogg1	A	C	6: 113,328,432	T69P	probably damaging	Het
Olfml2a	G	T	2: 38,957,721	V431L	probably damaging	Het
Olfr507	A	T	7: 108,622,504	M231L	probably benign	Het
Olfr984	T	C	9: 40,100,806	H228R	possibly damaging	Het
Palb2	G	T	7: 122,124,723	A601E	probably benign	Het
Pcdhb20	G	A	18: 37,505,796	M458I	probably benign	Het
Pde11a	T	C	2: 76,291,241	D332G	possibly damaging	Het
Pkd1l1	C	T	11: 8,958,964	E347K	unknown	Het
Pou2af1	G	A	9: 51,238,225	V206I	possibly damaging	Het
Prr16	A	G	18: 51,118,067	D46G	possibly damaging	Het
Pus1	A	G	5: 110,780,318	M1T	probably null	Het
Pygm	T	A	19: 6,391,409	V566D	possibly damaging	Het
Rb1	T	A	14: 73,262,514		probably benign	Het
Rhoj	A	T	12: 75,400,206	K200*	probably null	Het
Rnf213	A	G	11: 119,437,695	I1985V	possibly damaging	Het
Sept11	G	T	5: 93,162,254	M305I	possibly damaging	Het
Setdb2	T	C	14: 59,415,704	Y383C	probably damaging	Het
Sfpq	G	C	4: 127,021,611	Q65H	unknown	Het
Stard3nl	G	T	13: 19,370,264	A180E	probably damaging	Het
Tanc2	A	G	11: 105,910,240	N1094S	probably benign	Het
Trf	C	T	9: 103,211,985	A554T	possibly damaging	Het
Trmt13	T	C	3: 116,594,827		probably benign	Het
Tubb3	A	G	8: 123,420,919	D197G	probably damaging	Het
Ube2e3	A	G	2: 78,918,712	H135R	probably damaging	Het
Ugt1a10	A	T	1: 88,055,482	M1L	possibly damaging	Het
Vmn1r233	A	T	17: 20,994,415	I91N	possibly damaging	Het
Vmn2r88	A	T	14: 51,418,074	D580V	probably damaging	Het
Vps33b	A	G	7: 80,291,118	Y593C	probably benign	Het
Wdr19	A	G	5: 65,228,542	T622A	possibly damaging	Het
Wdr3	C	T	3: 100,140,200	R853Q	probably damaging	Het
Wdr61	A	G	9: 54,728,179	V46A	probably benign	Het
Xirp1	T	C	9: 120,016,506	T1104A	probably benign	Het
Yipf1	G	A	4: 107,344,683		probably null	Het
Zbtb17	A	G	4: 141,466,498	D651G	probably damaging	Het
Zbtb42	C	T	12: 112,680,542	R384W	probably damaging	Het
Zbtb43	A	T	2: 33,454,043	M390K	probably benign	Het
Zfp462	C	T	4: 55,011,889	T1285M	probably damaging	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TCCCTGTTTTGCAGTGGAGAAG -3'
(R):5'- CAGGCCCAAGTCACATCCTTTC -3'

Sequencing Primer
(F):5'- GTGGAGAAGCCGCCCCC -3'
(R):5'- AGTCACATCCTTTCCTTCTTTTATGG -3'

Posted On

2015-09-25