Incidental Mutation 'R4609:Fam160a2'
ID344513
Institutional Source Beutler Lab
Gene Symbol Fam160a2
Ensembl Gene ENSMUSG00000044465
Gene Namefamily with sequence similarity 160, member A2
Synonyms4632419K20Rik, 6530415H11Rik
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105371211-105400054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105388224 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 384 (I384T)
Ref Sequence ENSEMBL: ENSMUSP00000137163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048079] [ENSMUST00000074686] [ENSMUST00000118726] [ENSMUST00000122327] [ENSMUST00000137158] [ENSMUST00000179474] [ENSMUST00000210448] [ENSMUST00000211549]
Predicted Effect probably damaging
Transcript: ENSMUST00000048079
AA Change: I384T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045084
Gene: ENSMUSG00000044465
AA Change: I384T

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 2.8e-99 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074686
AA Change: I384T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074252
Gene: ENSMUSG00000044465
AA Change: I384T

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.4e-100 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 825 840 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118726
AA Change: I384T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112605
Gene: ENSMUSG00000044465
AA Change: I384T

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 1.8e-99 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 707 722 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122327
AA Change: I384T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112711
Gene: ENSMUSG00000044465
AA Change: I384T

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 5.6e-98 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136298
Predicted Effect probably benign
Transcript: ENSMUST00000137158
SMART Domains Protein: ENSMUSP00000119184
Gene: ENSMUSG00000044465

DomainStartEndE-ValueType
Pfam:RAI16-like 96 259 7.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179474
AA Change: I384T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137163
Gene: ENSMUSG00000044465
AA Change: I384T

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.2e-98 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 732 744 N/A INTRINSIC
low complexity region 905 920 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210341
Predicted Effect probably benign
Transcript: ENSMUST00000210448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211013
Predicted Effect probably benign
Transcript: ENSMUST00000211549
Meta Mutation Damage Score 0.8639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the FTS/Hook/FHIP (FHF) complex, which can interact with members of the homotypic vesicular protein sorting (HOPS) complex. This interaction suggests that the encoded protein is involved in vesicle trafficking. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Fam160a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Fam160a2 APN 7 105388260 missense probably damaging 1.00
IGL01972:Fam160a2 APN 7 105390145 missense probably damaging 0.99
IGL02054:Fam160a2 APN 7 105384423 missense probably damaging 1.00
IGL03037:Fam160a2 APN 7 105379086 missense probably benign 0.04
IGL03278:Fam160a2 APN 7 105385124 missense possibly damaging 0.93
IGL03340:Fam160a2 APN 7 105389310 missense probably damaging 1.00
IGL03374:Fam160a2 APN 7 105383951 missense probably damaging 1.00
R0426:Fam160a2 UTSW 7 105389473 missense probably damaging 1.00
R0482:Fam160a2 UTSW 7 105384212 missense possibly damaging 0.87
R0586:Fam160a2 UTSW 7 105389447 missense probably damaging 1.00
R0686:Fam160a2 UTSW 7 105388309 missense probably damaging 1.00
R1617:Fam160a2 UTSW 7 105385062 missense probably damaging 1.00
R2025:Fam160a2 UTSW 7 105388936 missense probably damaging 1.00
R2042:Fam160a2 UTSW 7 105384121 nonsense probably null
R2049:Fam160a2 UTSW 7 105389839 missense probably damaging 1.00
R2201:Fam160a2 UTSW 7 105388191 missense probably damaging 1.00
R3778:Fam160a2 UTSW 7 105388228 missense probably damaging 1.00
R4094:Fam160a2 UTSW 7 105388218 missense probably damaging 1.00
R4348:Fam160a2 UTSW 7 105385349 missense probably damaging 1.00
R4482:Fam160a2 UTSW 7 105389674 missense probably benign 0.06
R4742:Fam160a2 UTSW 7 105384311 missense probably damaging 0.99
R4977:Fam160a2 UTSW 7 105389335 missense probably damaging 1.00
R5642:Fam160a2 UTSW 7 105389882 missense probably damaging 1.00
R6404:Fam160a2 UTSW 7 105384991 nonsense probably null
R6906:Fam160a2 UTSW 7 105388269 missense probably damaging 1.00
R7053:Fam160a2 UTSW 7 105384572 missense probably damaging 1.00
R7265:Fam160a2 UTSW 7 105384225 missense probably benign 0.00
R7808:Fam160a2 UTSW 7 105384525 missense probably damaging 1.00
X0022:Fam160a2 UTSW 7 105389709 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGTGCCAGCTTGAAGTGAC -3'
(R):5'- TGGTCGACCAGTGAAAGGAC -3'

Sequencing Primer
(F):5'- CCAGCTTGAAGTGACTGCAG -3'
(R):5'- TCGACCAGTGAAAGGACTTATATG -3'
Posted On2015-09-25