Incidental Mutation 'R4609:Olfr507'
ID344514
Institutional Source Beutler Lab
Gene Symbol Olfr507
Ensembl Gene ENSMUSG00000061000
Gene Nameolfactory receptor 507
SynonymsGA_x6K02T2PBJ9-10951546-10952496, MOR204-7
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108621814-108622764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108622504 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 231 (M231L)
Ref Sequence ENSEMBL: ENSMUSP00000078926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080014]
Predicted Effect probably benign
Transcript: ENSMUST00000080014
AA Change: M231L

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078926
Gene: ENSMUSG00000061000
AA Change: M231L

DomainStartEndE-ValueType
Pfam:7tm_4 34 313 6.1e-52 PFAM
Pfam:7tm_1 44 295 1e-20 PFAM
Meta Mutation Damage Score 0.3133 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Olfr507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Olfr507 APN 7 108621857 missense probably damaging 1.00
IGL01979:Olfr507 APN 7 108622441 missense probably benign 0.09
IGL02373:Olfr507 APN 7 108622103 missense probably benign 0.11
IGL02754:Olfr507 APN 7 108622673 missense possibly damaging 0.94
IGL03008:Olfr507 APN 7 108622283 missense probably damaging 0.99
R0305:Olfr507 UTSW 7 108622585 missense probably benign 0.01
R0584:Olfr507 UTSW 7 108622415 missense probably benign 0.00
R0611:Olfr507 UTSW 7 108622287 missense possibly damaging 0.72
R0947:Olfr507 UTSW 7 108622672 missense probably benign 0.02
R1488:Olfr507 UTSW 7 108622489 missense probably damaging 1.00
R1808:Olfr507 UTSW 7 108622610 missense possibly damaging 0.87
R3763:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R4367:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4369:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4371:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R5389:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R6499:Olfr507 UTSW 7 108622506 missense probably benign 0.02
R6684:Olfr507 UTSW 7 108621934 missense probably damaging 0.98
R7531:Olfr507 UTSW 7 108622062 missense probably benign 0.06
R7555:Olfr507 UTSW 7 108622726 missense probably damaging 1.00
R7893:Olfr507 UTSW 7 108622637 missense probably damaging 1.00
R7976:Olfr507 UTSW 7 108622637 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTGTATCCAGTTGCTAGTGG -3'
(R):5'- CAACATGGGGATTGCTATCGC -3'

Sequencing Primer
(F):5'- CTCTTCTGTGGACCAAATAAAGTC -3'
(R):5'- GCTATCGCTATCATGTAAAACACAG -3'
Posted On2015-09-25