Incidental Mutation 'R4609:Olfr984'
ID344519
Institutional Source Beutler Lab
Gene Symbol Olfr984
Ensembl Gene ENSMUSG00000045812
Gene Nameolfactory receptor 984
SynonymsMOR239-6, GA_x6K02T2PVTD-33799484-33798540
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40096515-40114206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40100806 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 228 (H228R)
Ref Sequence ENSEMBL: ENSMUSP00000150287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056795] [ENSMUST00000213858] [ENSMUST00000214856] [ENSMUST00000217536]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056795
AA Change: H228R

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060787
Gene: ENSMUSG00000045812
AA Change: H228R

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-42 PFAM
Pfam:7tm_1 41 287 6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213858
AA Change: H228R

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214856
AA Change: H228R

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217536
AA Change: H228R

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.2716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Olfr984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Olfr984 APN 9 40101154 missense probably benign 0.03
IGL01402:Olfr984 APN 9 40101262 missense probably benign 0.00
IGL01404:Olfr984 APN 9 40101262 missense probably benign 0.00
IGL01445:Olfr984 APN 9 40101312 missense probably benign 0.45
IGL01448:Olfr984 APN 9 40101082 missense probably damaging 0.97
IGL02598:Olfr984 APN 9 40100565 missense probably benign
IGL03106:Olfr984 APN 9 40100734 missense probably damaging 1.00
R0616:Olfr984 UTSW 9 40100987 missense probably damaging 1.00
R0712:Olfr984 UTSW 9 40101430 missense probably benign
R2049:Olfr984 UTSW 9 40101119 missense probably benign
R2938:Olfr984 UTSW 9 40100743 missense probably benign 0.20
R4907:Olfr984 UTSW 9 40100659 missense probably benign 0.02
R5001:Olfr984 UTSW 9 40101227 missense probably benign 0.02
R5174:Olfr984 UTSW 9 40100747 missense possibly damaging 0.87
R5587:Olfr984 UTSW 9 40101244 missense probably damaging 1.00
R5880:Olfr984 UTSW 9 40101247 missense possibly damaging 0.95
R5896:Olfr984 UTSW 9 40100893 missense probably damaging 0.99
R6611:Olfr984 UTSW 9 40101020 missense probably benign 0.03
R6904:Olfr984 UTSW 9 40101356 missense probably benign 0.04
R7015:Olfr984 UTSW 9 40101455 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TAAATGGCAGGATTCAGCATGG -3'
(R):5'- TCCACTCCATTGTACAGGTTGG -3'

Sequencing Primer
(F):5'- CAGGATTCAGCATGGGGGTG -3'
(R):5'- GTACAGGTTGGACTGACTATCCATC -3'
Posted On2015-09-25