Incidental Mutation 'R4609:Bbs10'
ID344530
Institutional Source Beutler Lab
Gene Symbol Bbs10
Ensembl Gene ENSMUSG00000035759
Gene NameBardet-Biedl syndrome 10 (human)
Synonyms
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location111298679-111301727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111301134 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 703 (K703E)
Ref Sequence ENSEMBL: ENSMUSP00000049387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040454] [ENSMUST00000105275]
Predicted Effect probably benign
Transcript: ENSMUST00000040454
AA Change: K703E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000049387
Gene: ENSMUSG00000035759
AA Change: K703E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 17 103 3.6e-15 PFAM
Pfam:Cpn60_TCP1 139 427 1.1e-7 PFAM
SCOP:d1a6da1 567 695 3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105275
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219990
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by progressive retinal degeneration, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene is likely not a ciliary protein but rather has distant sequence homology to type II chaperonins. As a molecular chaperone, this protein may affect the folding or stability of other ciliary or basal body proteins. Inhibition of this protein's expression impairs ciliogenesis in preadipocytes. Mutations in this gene cause Bardet-Biedl syndrome type 10. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop obesity, hyperleptinemia, retinal degeneration, structural defects in renal glomeruli, microalbuminuria, polyuria, increased circulating antidiuretic hormone levels, and vacuolated renal epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Bbs10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Bbs10 UTSW 10 111298844 missense probably damaging 1.00
R0117:Bbs10 UTSW 10 111299333 missense possibly damaging 0.94
R0189:Bbs10 UTSW 10 111301065 missense probably damaging 1.00
R0373:Bbs10 UTSW 10 111300052 missense probably damaging 1.00
R0761:Bbs10 UTSW 10 111299383 missense probably damaging 1.00
R1319:Bbs10 UTSW 10 111298874 missense probably damaging 1.00
R1986:Bbs10 UTSW 10 111299257 missense probably damaging 1.00
R2015:Bbs10 UTSW 10 111300855 nonsense probably null
R2361:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3716:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3717:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4407:Bbs10 UTSW 10 111299859 missense probably benign 0.00
R4583:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4607:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4607:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4608:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4608:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4646:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4647:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4648:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4730:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4822:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4832:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R5056:Bbs10 UTSW 10 111300540 missense probably benign 0.00
R6285:Bbs10 UTSW 10 111299761 missense probably damaging 1.00
R6604:Bbs10 UTSW 10 111301104 missense possibly damaging 0.51
R7120:Bbs10 UTSW 10 111299449 missense possibly damaging 0.74
R7174:Bbs10 UTSW 10 111300767 nonsense probably null
R7376:Bbs10 UTSW 10 111299250 missense probably benign 0.08
R7701:Bbs10 UTSW 10 111300013 missense probably damaging 1.00
Z1176:Bbs10 UTSW 10 111298908 critical splice donor site probably null
Z1176:Bbs10 UTSW 10 111299657 missense probably benign 0.26
Z1176:Bbs10 UTSW 10 111301124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATACATGCGGTCTCTCCATG -3'
(R):5'- ACTTCAGTCAGCCAGAAGCC -3'

Sequencing Primer
(F):5'- GGTCTCTCCATGCACTGCAAG -3'
(R):5'- GTCTGCGAACATGTGTGTACAAC -3'
Posted On2015-09-25