Incidental Mutation 'R4609:Rnf213'
ID 344536
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission 041820-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Essential gene? Non essential (E-score: 0.000) question?
Stock # R4609 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 119393100-119487418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119437695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1985 (I1985V)
Ref Sequence ENSEMBL: ENSMUSP00000091429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000093902
AA Change: I1985V

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: I1985V

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000131035
AA Change: I1984V

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: I1984V

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 (GRCm38) D91G unknown Het
Adam10 T C 9: 70,740,143 (GRCm38) Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 (GRCm38) C183S probably damaging Het
Bbs10 A G 10: 111,301,134 (GRCm38) K703E probably benign Het
Bmp1 C T 14: 70,477,966 (GRCm38) V910M probably benign Het
Brdt G A 5: 107,359,936 (GRCm38) A677T probably benign Het
Cadps2 A T 6: 23,587,579 (GRCm38) M304K probably damaging Het
Car9 A T 4: 43,507,267 (GRCm38) D71V possibly damaging Het
Chml A T 1: 175,687,157 (GRCm38) Y399* probably null Het
Clasp1 A G 1: 118,503,035 (GRCm38) probably benign Het
Cntnap5b G A 1: 99,772,847 (GRCm38) probably null Het
Cpvl A T 6: 53,974,620 (GRCm38) probably null Het
Crocc2 G A 1: 93,168,794 (GRCm38) V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 (GRCm38) Y226C probably damaging Het
Dio3 G T 12: 110,280,010 (GRCm38) R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 (GRCm38) L724P probably damaging Het
Dnah7a A C 1: 53,456,657 (GRCm38) F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 (GRCm38) Y223* probably null Het
Dpysl4 T C 7: 139,098,621 (GRCm38) V499A probably damaging Het
Ets2 A T 16: 95,711,774 (GRCm38) K101N probably benign Het
Fam160a2 A G 7: 105,388,224 (GRCm38) I384T probably damaging Het
Fbn2 A T 18: 58,190,269 (GRCm38) Y200* probably null Het
Fem1c A T 18: 46,505,948 (GRCm38) I329N probably damaging Het
Gm8919 T C 3: 11,659,470 (GRCm38) noncoding transcript Het
H2-Q5 A T 17: 35,397,080 (GRCm38) H206L probably benign Het
Hexa T C 9: 59,557,319 (GRCm38) F164S probably benign Het
Hk1 G T 10: 62,358,415 (GRCm38) probably benign Het
Ick T A 9: 78,167,789 (GRCm38) probably benign Het
Itih4 G A 14: 30,901,669 (GRCm38) G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 (GRCm38) probably null Het
Krtap10-4 A T 10: 77,826,796 (GRCm38) probably benign Het
Maml3 G T 3: 51,855,592 (GRCm38) H650Q probably damaging Het
Mief1 C A 15: 80,248,253 (GRCm38) P112Q probably benign Het
Morc3 A G 16: 93,864,968 (GRCm38) E472G probably benign Het
Nap1l1 T A 10: 111,492,880 (GRCm38) Y223* probably null Het
Nfix A T 8: 84,726,490 (GRCm38) W312R probably damaging Het
Nfkbie A T 17: 45,558,584 (GRCm38) N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 (GRCm38) M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 (GRCm38) Y299F probably benign Het
Nnt T C 13: 119,357,536 (GRCm38) I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 (GRCm38) I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 (GRCm38) T69P probably damaging Het
Olfml2a G T 2: 38,957,721 (GRCm38) V431L probably damaging Het
Olfr507 A T 7: 108,622,504 (GRCm38) M231L probably benign Het
Olfr984 T C 9: 40,100,806 (GRCm38) H228R possibly damaging Het
Palb2 G T 7: 122,124,723 (GRCm38) A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 (GRCm38) M458I probably benign Het
Pde11a T C 2: 76,291,241 (GRCm38) D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 (GRCm38) E347K unknown Het
Pou2af1 G A 9: 51,238,225 (GRCm38) V206I possibly damaging Het
Prr16 A G 18: 51,118,067 (GRCm38) D46G possibly damaging Het
Pus1 A G 5: 110,780,318 (GRCm38) M1T probably null Het
Pygm T A 19: 6,391,409 (GRCm38) V566D possibly damaging Het
Rb1 T A 14: 73,262,514 (GRCm38) probably benign Het
Rhoj A T 12: 75,400,206 (GRCm38) K200* probably null Het
Sept11 G T 5: 93,162,254 (GRCm38) M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 (GRCm38) Y383C probably damaging Het
Sfpq G C 4: 127,021,611 (GRCm38) Q65H unknown Het
Stard3nl G T 13: 19,370,264 (GRCm38) A180E probably damaging Het
Tanc2 A G 11: 105,910,240 (GRCm38) N1094S probably benign Het
Trf C T 9: 103,211,985 (GRCm38) A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 (GRCm38) probably benign Het
Tubb3 A G 8: 123,420,919 (GRCm38) D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 (GRCm38) H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 (GRCm38) M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 (GRCm38) I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 (GRCm38) D580V probably damaging Het
Vps33b A G 7: 80,291,118 (GRCm38) Y593C probably benign Het
Wdr19 A G 5: 65,228,542 (GRCm38) T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 (GRCm38) R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 (GRCm38) V46A probably benign Het
Xirp1 T C 9: 120,016,506 (GRCm38) T1104A probably benign Het
Yipf1 G A 4: 107,344,683 (GRCm38) probably null Het
Zbtb17 A G 4: 141,466,498 (GRCm38) D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 (GRCm38) R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 (GRCm38) M390K probably benign Het
Zfp462 C T 4: 55,011,889 (GRCm38) T1285M probably damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119,449,343 (GRCm38) missense probably benign 0.00
IGL00961:Rnf213 APN 11 119,440,843 (GRCm38) missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119,447,237 (GRCm38) missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119,483,118 (GRCm38) missense probably benign 0.25
IGL01403:Rnf213 APN 11 119,443,300 (GRCm38) missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119,449,876 (GRCm38) critical splice donor site probably null
IGL01765:Rnf213 APN 11 119,436,352 (GRCm38) missense probably benign 0.00
IGL01803:Rnf213 APN 11 119,441,307 (GRCm38) missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119,442,266 (GRCm38) missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119,443,015 (GRCm38) missense probably benign 0.05
IGL01944:Rnf213 APN 11 119,416,457 (GRCm38) missense probably benign 0.01
IGL01982:Rnf213 APN 11 119,443,268 (GRCm38) missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119,418,309 (GRCm38) splice site probably benign
IGL02084:Rnf213 APN 11 119,445,673 (GRCm38) missense probably benign 0.04
IGL02253:Rnf213 APN 11 119,440,650 (GRCm38) missense probably benign 0.03
IGL02254:Rnf213 APN 11 119,480,907 (GRCm38) missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119,463,336 (GRCm38) missense probably benign 0.01
IGL02531:Rnf213 APN 11 119,436,802 (GRCm38) missense probably benign
IGL02588:Rnf213 APN 11 119,416,536 (GRCm38) missense probably benign 0.30
IGL02615:Rnf213 APN 11 119,440,789 (GRCm38) missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119,435,066 (GRCm38) missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119,427,510 (GRCm38) missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119,479,941 (GRCm38) missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119,445,626 (GRCm38) splice site probably benign
IGL03057:Rnf213 APN 11 119,441,087 (GRCm38) missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119,465,007 (GRCm38) missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119,474,172 (GRCm38) missense probably benign 0.03
IGL03339:Rnf213 APN 11 119,443,004 (GRCm38) missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119,421,468 (GRCm38) missense probably benign 0.34
attrition UTSW 11 119,430,321 (GRCm38) missense possibly damaging 0.77
defame UTSW 11 119,430,281 (GRCm38) nonsense probably null
Derogate UTSW 11 119,470,210 (GRCm38) missense probably damaging 1.00
dinky UTSW 11 119,416,458 (GRCm38) missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119,434,742 (GRCm38) missense
Impugn UTSW 11 119,436,823 (GRCm38) nonsense probably null
R4332_Rnf213_642 UTSW 11 119,436,676 (GRCm38) missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119,426,069 (GRCm38) missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119,434,742 (GRCm38) missense
PIT4585001:Rnf213 UTSW 11 119,458,392 (GRCm38) missense
R0008:Rnf213 UTSW 11 119,465,052 (GRCm38) missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119,441,606 (GRCm38) missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119,402,575 (GRCm38) missense probably benign 0.41
R0114:Rnf213 UTSW 11 119,414,587 (GRCm38) missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0131:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0132:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0138:Rnf213 UTSW 11 119,416,496 (GRCm38) missense probably benign 0.05
R0144:Rnf213 UTSW 11 119,479,600 (GRCm38) nonsense probably null
R0184:Rnf213 UTSW 11 119,414,521 (GRCm38) missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119,438,105 (GRCm38) nonsense probably null
R0365:Rnf213 UTSW 11 119,426,111 (GRCm38) missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119,414,469 (GRCm38) missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119,447,257 (GRCm38) missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119,426,012 (GRCm38) missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119,443,120 (GRCm38) missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119,465,082 (GRCm38) missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119,443,280 (GRCm38) missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119,431,717 (GRCm38) missense probably benign 0.03
R0638:Rnf213 UTSW 11 119,470,210 (GRCm38) missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119,441,834 (GRCm38) missense probably benign 0.28
R0715:Rnf213 UTSW 11 119,441,150 (GRCm38) missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119,441,068 (GRCm38) missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119,473,480 (GRCm38) missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119,423,095 (GRCm38) critical splice donor site probably null
R0890:Rnf213 UTSW 11 119,430,486 (GRCm38) missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119,414,570 (GRCm38) missense probably benign 0.00
R0940:Rnf213 UTSW 11 119,416,563 (GRCm38) missense probably benign 0.10
R0959:Rnf213 UTSW 11 119,452,581 (GRCm38) missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119,485,998 (GRCm38) splice site probably benign
R1104:Rnf213 UTSW 11 119,477,229 (GRCm38) missense probably benign 0.29
R1141:Rnf213 UTSW 11 119,435,983 (GRCm38) missense probably benign 0.02
R1219:Rnf213 UTSW 11 119,436,177 (GRCm38) missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119,436,005 (GRCm38) missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119,442,400 (GRCm38) missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119,437,750 (GRCm38) missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119,480,889 (GRCm38) missense probably benign 0.05
R1523:Rnf213 UTSW 11 119,441,888 (GRCm38) missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119,442,707 (GRCm38) missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119,441,839 (GRCm38) missense probably benign 0.06
R1563:Rnf213 UTSW 11 119,414,526 (GRCm38) missense probably benign 0.13
R1572:Rnf213 UTSW 11 119,436,611 (GRCm38) missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119,463,345 (GRCm38) missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119,442,579 (GRCm38) missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119,437,672 (GRCm38) missense probably benign 0.01
R1789:Rnf213 UTSW 11 119,440,221 (GRCm38) missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119,441,183 (GRCm38) missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119,450,129 (GRCm38) missense probably benign 0.08
R1893:Rnf213 UTSW 11 119,416,448 (GRCm38) missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119,431,685 (GRCm38) missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119,480,895 (GRCm38) missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119,441,107 (GRCm38) missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119,436,022 (GRCm38) missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119,461,918 (GRCm38) missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119,467,302 (GRCm38) nonsense probably null
R2109:Rnf213 UTSW 11 119,442,663 (GRCm38) nonsense probably null
R2115:Rnf213 UTSW 11 119,428,013 (GRCm38) missense probably benign 0.00
R2126:Rnf213 UTSW 11 119,450,201 (GRCm38) missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119,443,690 (GRCm38) missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119,415,193 (GRCm38) missense probably benign 0.03
R2168:Rnf213 UTSW 11 119,415,070 (GRCm38) missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R2199:Rnf213 UTSW 11 119,460,009 (GRCm38) missense probably benign 0.01
R2220:Rnf213 UTSW 11 119,436,428 (GRCm38) missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119,414,604 (GRCm38) missense probably benign 0.02
R2400:Rnf213 UTSW 11 119,443,195 (GRCm38) missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119,459,938 (GRCm38) splice site probably null
R2698:Rnf213 UTSW 11 119,410,144 (GRCm38) missense probably benign 0.26
R3151:Rnf213 UTSW 11 119,468,892 (GRCm38) missense probably benign 0.03
R3607:Rnf213 UTSW 11 119,441,976 (GRCm38) nonsense probably null
R3808:Rnf213 UTSW 11 119,479,558 (GRCm38) missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119,480,939 (GRCm38) splice site probably benign
R3856:Rnf213 UTSW 11 119,480,939 (GRCm38) splice site probably benign
R3973:Rnf213 UTSW 11 119,469,053 (GRCm38) missense
R4014:Rnf213 UTSW 11 119,445,729 (GRCm38) nonsense probably null
R4049:Rnf213 UTSW 11 119,482,448 (GRCm38) missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119,483,006 (GRCm38) missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119,409,482 (GRCm38) missense probably benign 0.27
R4167:Rnf213 UTSW 11 119,441,243 (GRCm38) missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119,436,823 (GRCm38) nonsense probably null
R4332:Rnf213 UTSW 11 119,436,676 (GRCm38) missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119,483,964 (GRCm38) missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119,479,670 (GRCm38) critical splice donor site probably null
R4684:Rnf213 UTSW 11 119,441,125 (GRCm38) missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119,440,349 (GRCm38) missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119,420,067 (GRCm38) missense probably benign 0.38
R4751:Rnf213 UTSW 11 119,445,745 (GRCm38) missense probably benign 0.12
R4828:Rnf213 UTSW 11 119,416,629 (GRCm38) missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119,442,763 (GRCm38) missense probably benign 0.00
R4894:Rnf213 UTSW 11 119,481,240 (GRCm38) missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119,428,157 (GRCm38) missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119,436,764 (GRCm38) missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119,410,807 (GRCm38) missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119,458,866 (GRCm38) missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119,440,816 (GRCm38) missense probably benign 0.00
R5406:Rnf213 UTSW 11 119,440,808 (GRCm38) missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119,409,020 (GRCm38) missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119,415,076 (GRCm38) missense probably benign 0.44
R5520:Rnf213 UTSW 11 119,433,499 (GRCm38) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,436,905 (GRCm38) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,436,629 (GRCm38) missense probably benign 0.04
R5669:Rnf213 UTSW 11 119,458,785 (GRCm38) missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119,434,686 (GRCm38) critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119,483,894 (GRCm38) missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119,416,458 (GRCm38) missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119,436,295 (GRCm38) missense probably benign
R5861:Rnf213 UTSW 11 119,473,377 (GRCm38) missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119,421,369 (GRCm38) missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119,443,079 (GRCm38) missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119,486,010 (GRCm38) missense probably benign 0.00
R6043:Rnf213 UTSW 11 119,442,101 (GRCm38) missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119,416,559 (GRCm38) missense probably benign 0.14
R6123:Rnf213 UTSW 11 119,411,513 (GRCm38) missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119,411,470 (GRCm38) missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119,442,028 (GRCm38) missense probably benign 0.02
R6146:Rnf213 UTSW 11 119,435,999 (GRCm38) missense probably benign 0.41
R6163:Rnf213 UTSW 11 119,458,428 (GRCm38) missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119,414,548 (GRCm38) missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119,463,366 (GRCm38) missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119,477,078 (GRCm38) missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119,459,966 (GRCm38) missense probably benign 0.03
R6468:Rnf213 UTSW 11 119,452,687 (GRCm38) missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119,436,280 (GRCm38) missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119,479,920 (GRCm38) missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119,430,321 (GRCm38) missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119,442,271 (GRCm38) missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119,442,236 (GRCm38) missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119,462,285 (GRCm38) critical splice donor site probably null
R6820:Rnf213 UTSW 11 119,448,838 (GRCm38) missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119,449,866 (GRCm38) missense probably benign 0.26
R6934:Rnf213 UTSW 11 119,420,067 (GRCm38) missense probably benign 0.38
R7026:Rnf213 UTSW 11 119,479,655 (GRCm38) missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119,437,604 (GRCm38) splice site probably null
R7170:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7185:Rnf213 UTSW 11 119,424,198 (GRCm38) missense
R7239:Rnf213 UTSW 11 119,458,788 (GRCm38) missense
R7258:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7259:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7260:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7273:Rnf213 UTSW 11 119,431,756 (GRCm38) splice site probably null
R7282:Rnf213 UTSW 11 119,437,992 (GRCm38) missense
R7311:Rnf213 UTSW 11 119,416,547 (GRCm38) missense
R7352:Rnf213 UTSW 11 119,443,579 (GRCm38) missense
R7369:Rnf213 UTSW 11 119,430,468 (GRCm38) missense
R7410:Rnf213 UTSW 11 119,435,051 (GRCm38) missense
R7448:Rnf213 UTSW 11 119,481,291 (GRCm38) missense
R7561:Rnf213 UTSW 11 119,441,719 (GRCm38) missense
R7573:Rnf213 UTSW 11 119,458,484 (GRCm38) missense
R7615:Rnf213 UTSW 11 119,467,297 (GRCm38) missense
R7680:Rnf213 UTSW 11 119,479,556 (GRCm38) missense
R7739:Rnf213 UTSW 11 119,410,861 (GRCm38) missense
R7789:Rnf213 UTSW 11 119,470,219 (GRCm38) splice site probably null
R7806:Rnf213 UTSW 11 119,411,545 (GRCm38) missense
R8031:Rnf213 UTSW 11 119,430,281 (GRCm38) nonsense probably null
R8042:Rnf213 UTSW 11 119,441,654 (GRCm38) missense
R8053:Rnf213 UTSW 11 119,402,647 (GRCm38) missense
R8284:Rnf213 UTSW 11 119,428,083 (GRCm38) missense
R8301:Rnf213 UTSW 11 119,434,742 (GRCm38) missense
R8325:Rnf213 UTSW 11 119,430,445 (GRCm38) missense
R8332:Rnf213 UTSW 11 119,483,698 (GRCm38) missense
R8443:Rnf213 UTSW 11 119,449,323 (GRCm38) missense
R8518:Rnf213 UTSW 11 119,462,217 (GRCm38) missense
R8531:Rnf213 UTSW 11 119,474,205 (GRCm38) missense probably benign 0.02
R8670:Rnf213 UTSW 11 119,458,737 (GRCm38) missense
R8675:Rnf213 UTSW 11 119,456,158 (GRCm38) missense
R8690:Rnf213 UTSW 11 119,441,212 (GRCm38) missense
R8690:Rnf213 UTSW 11 119,418,129 (GRCm38) missense
R8714:Rnf213 UTSW 11 119,468,894 (GRCm38) missense
R8802:Rnf213 UTSW 11 119,462,102 (GRCm38) missense
R8861:Rnf213 UTSW 11 119,442,236 (GRCm38) missense
R8886:Rnf213 UTSW 11 119,473,438 (GRCm38) missense
R8893:Rnf213 UTSW 11 119,443,042 (GRCm38) missense
R8937:Rnf213 UTSW 11 119,430,274 (GRCm38) missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119,414,424 (GRCm38) missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119,461,930 (GRCm38) missense
R8983:Rnf213 UTSW 11 119,430,349 (GRCm38) missense
R9043:Rnf213 UTSW 11 119,458,913 (GRCm38) missense
R9081:Rnf213 UTSW 11 119,466,236 (GRCm38) missense
R9132:Rnf213 UTSW 11 119,483,916 (GRCm38) missense
R9135:Rnf213 UTSW 11 119,408,747 (GRCm38) missense
R9146:Rnf213 UTSW 11 119,443,673 (GRCm38) missense
R9156:Rnf213 UTSW 11 119,440,748 (GRCm38) missense
R9183:Rnf213 UTSW 11 119,427,622 (GRCm38) missense
R9234:Rnf213 UTSW 11 119,450,117 (GRCm38) missense
R9275:Rnf213 UTSW 11 119,435,942 (GRCm38) missense
R9278:Rnf213 UTSW 11 119,435,942 (GRCm38) missense
R9296:Rnf213 UTSW 11 119,443,795 (GRCm38) splice site probably benign
R9350:Rnf213 UTSW 11 119,442,149 (GRCm38) missense
R9366:Rnf213 UTSW 11 119,436,231 (GRCm38) missense
R9413:Rnf213 UTSW 11 119,466,233 (GRCm38) missense
R9444:Rnf213 UTSW 11 119,434,797 (GRCm38) missense
R9464:Rnf213 UTSW 11 119,463,580 (GRCm38) missense
R9605:Rnf213 UTSW 11 119,469,053 (GRCm38) missense
R9649:Rnf213 UTSW 11 119,479,631 (GRCm38) missense
R9651:Rnf213 UTSW 11 119,440,412 (GRCm38) missense
R9664:Rnf213 UTSW 11 119,441,968 (GRCm38) missense
R9696:Rnf213 UTSW 11 119,468,980 (GRCm38) missense
R9710:Rnf213 UTSW 11 119,441,005 (GRCm38) missense
R9797:Rnf213 UTSW 11 119,442,539 (GRCm38) missense
S24628:Rnf213 UTSW 11 119,414,469 (GRCm38) missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119,441,824 (GRCm38) missense probably benign 0.14
X0062:Rnf213 UTSW 11 119,473,513 (GRCm38) missense probably benign 0.05
X0064:Rnf213 UTSW 11 119,440,463 (GRCm38) missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119,477,254 (GRCm38) missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119,482,998 (GRCm38) missense
Z1176:Rnf213 UTSW 11 119,441,410 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- TCTGGCTTGAATCAGAATCGC -3'
(R):5'- TCACCCTACAGAGCTGCTTG -3'

Sequencing Primer
(F):5'- CTCTCTACGTGAACACAC -3'
(R):5'- CCTTGACAGGATGCATGCGTAG -3'
Posted On 2015-09-25