Incidental Mutation 'R4609:Itih4'
ID344542
Institutional Source Beutler Lab
Gene Symbol Itih4
Ensembl Gene ENSMUSG00000021922
Gene Nameinter alpha-trypsin inhibitor, heavy chain 4
SynonymsItih-4
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30886476-30902353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30901669 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 915 (G915R)
Ref Sequence ENSEMBL: ENSMUSP00000125920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006703] [ENSMUST00000078490] [ENSMUST00000120269] [ENSMUST00000168782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006703
AA Change: G892R

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006703
Gene: ENSMUSG00000021922
AA Change: G892R

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 781 941 2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078490
AA Change: G931R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077580
Gene: ENSMUSG00000021922
AA Change: G931R

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 777 941 2.2e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120269
AA Change: G932R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112798
Gene: ENSMUSG00000021922
AA Change: G932R

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 738 902 6.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134988
Predicted Effect probably damaging
Transcript: ENSMUST00000168782
AA Change: G915R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125920
Gene: ENSMUSG00000021922
AA Change: G915R

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 761 925 2.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227899
Meta Mutation Damage Score 0.8275 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a member of the inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors with diverse functions as anti-apoptotic and matrix stabilizing molecules during development. This gene is predominantly expressed in the liver and the encoded protein was found to be a plasma kallikrein-sensitive glycoprotein. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal. Surprisingly, IL-6/STAT3 signaling is significantly suppressed in mutant liver tissues but hepatocytes remain well differentiated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Itih4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itih4 APN 14 30895469 missense probably damaging 0.97
IGL00776:Itih4 APN 14 30889604 missense probably benign 0.03
IGL01309:Itih4 APN 14 30891749 missense probably damaging 1.00
IGL01433:Itih4 APN 14 30895448 missense probably benign 0.01
IGL01598:Itih4 APN 14 30887817 missense possibly damaging 0.92
IGL02332:Itih4 APN 14 30887860 missense probably damaging 1.00
IGL03075:Itih4 APN 14 30892283 missense probably benign 0.02
IGL03304:Itih4 APN 14 30898049 missense probably damaging 0.98
IGL03353:Itih4 APN 14 30887844 missense probably damaging 1.00
IGL03396:Itih4 APN 14 30887949 missense probably damaging 1.00
PIT4453001:Itih4 UTSW 14 30901170 missense probably benign 0.29
R0304:Itih4 UTSW 14 30890094 splice site probably null
R0477:Itih4 UTSW 14 30889674 missense probably damaging 1.00
R0783:Itih4 UTSW 14 30895423 missense possibly damaging 0.84
R0882:Itih4 UTSW 14 30892274 missense probably damaging 1.00
R1118:Itih4 UTSW 14 30896167 splice site probably benign
R1126:Itih4 UTSW 14 30889961 critical splice donor site probably null
R1238:Itih4 UTSW 14 30887949 missense probably damaging 1.00
R1456:Itih4 UTSW 14 30892653 missense probably benign 0.31
R1573:Itih4 UTSW 14 30897547 missense probably benign 0.00
R1695:Itih4 UTSW 14 30891499 critical splice donor site probably null
R2085:Itih4 UTSW 14 30892323 missense possibly damaging 0.91
R2093:Itih4 UTSW 14 30891737 missense probably damaging 1.00
R2213:Itih4 UTSW 14 30890713 missense probably damaging 0.99
R2249:Itih4 UTSW 14 30899394 nonsense probably null
R2267:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2268:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2508:Itih4 UTSW 14 30895478 missense probably damaging 1.00
R3724:Itih4 UTSW 14 30892584 missense possibly damaging 0.60
R3859:Itih4 UTSW 14 30892329 missense probably damaging 1.00
R4042:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4044:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4246:Itih4 UTSW 14 30891402 missense probably damaging 1.00
R4422:Itih4 UTSW 14 30889864 missense probably damaging 1.00
R4553:Itih4 UTSW 14 30900953 missense probably damaging 1.00
R4581:Itih4 UTSW 14 30900968 missense probably benign 0.01
R4608:Itih4 UTSW 14 30901669 missense probably damaging 1.00
R4726:Itih4 UTSW 14 30889835 missense probably damaging 1.00
R4790:Itih4 UTSW 14 30889910 missense probably damaging 1.00
R4975:Itih4 UTSW 14 30892287 missense probably damaging 1.00
R5004:Itih4 UTSW 14 30892672 missense probably damaging 1.00
R5911:Itih4 UTSW 14 30890655 missense possibly damaging 0.90
R6014:Itih4 UTSW 14 30892629 missense probably benign 0.01
R6957:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7012:Itih4 UTSW 14 30890749 missense probably benign 0.16
R7075:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7195:Itih4 UTSW 14 30899475 missense probably damaging 1.00
R7231:Itih4 UTSW 14 30896614 missense probably benign 0.17
R7509:Itih4 UTSW 14 30895447 missense probably benign 0.08
R7819:Itih4 UTSW 14 30901663 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTGAATAATCCTTGGGCAACTG -3'
(R):5'- AACTGCCTGGGTTCACACTG -3'

Sequencing Primer
(F):5'- CCTGGCCTGTATCAGAGGGAATTC -3'
(R):5'- GCCCTTCTTTATTTGTAACAAGGGAG -3'
Posted On2015-09-25