Incidental Mutation 'R4609:Bmp1'
ID344545
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Namebone morphogenetic protein 1
Synonyms
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70474558-70520234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70477966 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 910 (V910M)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226906] [ENSMUST00000227944]
Predicted Effect probably benign
Transcript: ENSMUST00000022693
AA Change: V910M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: V910M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228501
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70492461 missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70486220 missense probably damaging 0.97
IGL02065:Bmp1 APN 14 70490107 missense probably damaging 0.99
IGL02349:Bmp1 APN 14 70507549 missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70504776 missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70490029 missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70490034 missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70508004 missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70486265 missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70508831 missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70486272 missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70492107 missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70490542 splice site probably null
R4613:Bmp1 UTSW 14 70508523 missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70492844 missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70492073 splice site probably null
R4884:Bmp1 UTSW 14 70475215 missense probably benign 0.01
R4905:Bmp1 UTSW 14 70491362 missense probably benign 0.06
R5088:Bmp1 UTSW 14 70486219 missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70480165 missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70508128 missense probably benign 0.34
R5625:Bmp1 UTSW 14 70486166 missense probably benign 0.19
R5653:Bmp1 UTSW 14 70490094 missense probably benign 0.00
R6155:Bmp1 UTSW 14 70508007 missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70491383 missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70491368 missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70508858 missense probably benign 0.26
R6983:Bmp1 UTSW 14 70508207 missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70479560 missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70490122 missense probably benign 0.44
R7716:Bmp1 UTSW 14 70477922 nonsense probably null
R7749:Bmp1 UTSW 14 70492844 missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70492084 missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70508565 missense probably damaging 1.00
R7917:Bmp1 UTSW 14 70508565 missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70508537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTCAGCCTAGTACCCTAG -3'
(R):5'- ATCATCACACACTGATCGGTC -3'

Sequencing Primer
(F):5'- TAGTACCCTAGGTCTCCAGGGATG -3'
(R):5'- ATCGGTCATCAGTGGTGATCAATC -3'
Posted On2015-09-25