Incidental Mutation 'R4609:Bmp1'
ID 344545
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 041820-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4609 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70715406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 910 (V910M)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably benign
Transcript: ENSMUST00000022693
AA Change: V910M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: V910M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228501
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,378,370 (GRCm39) D91G unknown Het
Adam10 T C 9: 70,647,425 (GRCm39) Y42H probably damaging Het
Baiap3 A T 17: 25,469,235 (GRCm39) C183S probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Brdt G A 5: 107,507,802 (GRCm39) A677T probably benign Het
Cadps2 A T 6: 23,587,578 (GRCm39) M304K probably damaging Het
Car9 A T 4: 43,507,267 (GRCm39) D71V possibly damaging Het
Chml A T 1: 175,514,723 (GRCm39) Y399* probably null Het
Cilk1 T A 9: 78,075,071 (GRCm39) probably benign Het
Clasp1 A G 1: 118,430,765 (GRCm39) probably benign Het
Cntnap5b G A 1: 99,700,572 (GRCm39) probably null Het
Cpvl A T 6: 53,951,605 (GRCm39) probably null Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
Cxcl16 T C 11: 70,346,255 (GRCm39) Y226C probably damaging Het
Dio3 G T 12: 110,246,444 (GRCm39) R260L probably damaging Het
Dmxl2 A G 9: 54,353,796 (GRCm39) L724P probably damaging Het
Dnah7a A C 1: 53,495,816 (GRCm39) F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 (GRCm39) Y223* probably null Het
Dpysl4 T C 7: 138,678,537 (GRCm39) V499A probably damaging Het
Ets2 A T 16: 95,512,818 (GRCm39) K101N probably benign Het
Fbn2 A T 18: 58,323,341 (GRCm39) Y200* probably null Het
Fem1c A T 18: 46,639,015 (GRCm39) I329N probably damaging Het
Fhip1b A G 7: 105,037,431 (GRCm39) I384T probably damaging Het
Gm8919 T C 3: 11,724,530 (GRCm39) noncoding transcript Het
H2-Q5 A T 17: 35,616,056 (GRCm39) H206L probably benign Het
Hexa T C 9: 59,464,602 (GRCm39) F164S probably benign Het
Hk1 G T 10: 62,194,194 (GRCm39) probably benign Het
Itih4 G A 14: 30,623,626 (GRCm39) G915R probably damaging Het
Kcnq5 A T 1: 21,475,292 (GRCm39) probably null Het
Krtap10-4 A T 10: 77,662,630 (GRCm39) probably benign Het
Maml3 G T 3: 51,763,013 (GRCm39) H650Q probably damaging Het
Mief1 C A 15: 80,132,454 (GRCm39) P112Q probably benign Het
Morc3 A G 16: 93,661,856 (GRCm39) E472G probably benign Het
Nap1l1 T A 10: 111,328,741 (GRCm39) Y223* probably null Het
Nfix A T 8: 85,453,119 (GRCm39) W312R probably damaging Het
Nfkbie A T 17: 45,869,510 (GRCm39) N155I probably damaging Het
Nlgn2 A T 11: 69,724,912 (GRCm39) M118K probably damaging Het
Nlrp5 A T 7: 23,117,173 (GRCm39) Y299F probably benign Het
Nnt T C 13: 119,494,072 (GRCm39) I556V possibly damaging Het
Oasl2 A T 5: 115,037,857 (GRCm39) I85F possibly damaging Het
Ogg1 A C 6: 113,305,393 (GRCm39) T69P probably damaging Het
Olfml2a G T 2: 38,847,733 (GRCm39) V431L probably damaging Het
Or4d5 T C 9: 40,012,102 (GRCm39) H228R possibly damaging Het
Or5p79 A T 7: 108,221,711 (GRCm39) M231L probably benign Het
Palb2 G T 7: 121,723,946 (GRCm39) A601E probably benign Het
Pcdhb20 G A 18: 37,638,849 (GRCm39) M458I probably benign Het
Pde11a T C 2: 76,121,585 (GRCm39) D332G possibly damaging Het
Pkd1l1 C T 11: 8,908,964 (GRCm39) E347K unknown Het
Pou2af1 G A 9: 51,149,525 (GRCm39) V206I possibly damaging Het
Prr16 A G 18: 51,251,139 (GRCm39) D46G possibly damaging Het
Pus1 A G 5: 110,928,184 (GRCm39) M1T probably null Het
Pygm T A 19: 6,441,439 (GRCm39) V566D possibly damaging Het
Rb1 T A 14: 73,499,954 (GRCm39) probably benign Het
Rhoj A T 12: 75,446,980 (GRCm39) K200* probably null Het
Rnf213 A G 11: 119,328,521 (GRCm39) I1985V possibly damaging Het
Septin11 G T 5: 93,310,113 (GRCm39) M305I possibly damaging Het
Setdb2 T C 14: 59,653,153 (GRCm39) Y383C probably damaging Het
Sfpq G C 4: 126,915,404 (GRCm39) Q65H unknown Het
Skic8 A G 9: 54,635,463 (GRCm39) V46A probably benign Het
Stard3nl G T 13: 19,554,434 (GRCm39) A180E probably damaging Het
Tanc2 A G 11: 105,801,066 (GRCm39) N1094S probably benign Het
Trf C T 9: 103,089,184 (GRCm39) A554T possibly damaging Het
Trmt13 T C 3: 116,388,476 (GRCm39) probably benign Het
Tubb3 A G 8: 124,147,658 (GRCm39) D197G probably damaging Het
Ube2e3 A G 2: 78,749,056 (GRCm39) H135R probably damaging Het
Ugt1a10 A T 1: 87,983,204 (GRCm39) M1L possibly damaging Het
Vmn1r233 A T 17: 21,214,677 (GRCm39) I91N possibly damaging Het
Vmn2r88 A T 14: 51,655,531 (GRCm39) D580V probably damaging Het
Vps33b A G 7: 79,940,866 (GRCm39) Y593C probably benign Het
Wdr19 A G 5: 65,385,885 (GRCm39) T622A possibly damaging Het
Wdr3 C T 3: 100,047,516 (GRCm39) R853Q probably damaging Het
Xirp1 T C 9: 119,845,572 (GRCm39) T1104A probably benign Het
Yipf1 G A 4: 107,201,880 (GRCm39) probably null Het
Zbtb17 A G 4: 141,193,809 (GRCm39) D651G probably damaging Het
Zbtb42 C T 12: 112,646,976 (GRCm39) R384W probably damaging Het
Zbtb43 A T 2: 33,344,055 (GRCm39) M390K probably benign Het
Zfp462 C T 4: 55,011,889 (GRCm39) T1285M probably damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTCAGCCTAGTACCCTAG -3'
(R):5'- ATCATCACACACTGATCGGTC -3'

Sequencing Primer
(F):5'- TAGTACCCTAGGTCTCCAGGGATG -3'
(R):5'- ATCGGTCATCAGTGGTGATCAATC -3'
Posted On 2015-09-25