Incidental Mutation 'R4610:Rev1'
ID344560
Institutional Source Beutler Lab
Gene Symbol Rev1
Ensembl Gene ENSMUSG00000026082
Gene NameREV1, DNA directed polymerase
SynonymsREV1, Rev1l, 1110027I23Rik
MMRRC Submission 041821-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R4610 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location38052786-38129801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38053649 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1202 (E1202G)
Ref Sequence ENSEMBL: ENSMUSP00000027251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000027252]
PDB Structure
Solution structure of the mouse Rev1 C-terminal domain [SOLUTION NMR]
Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa [SOLUTION NMR]
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027251
AA Change: E1202G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082
AA Change: E1202G

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027252
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195664
Meta Mutation Damage Score 0.6795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal somatic hypermutation frequency of the Ig gene. Mice homozygous for a knock-out allele exhibit background-sensitive prenatal lethality and abnormal somatic hypermutation frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Adgre1 C A 17: 57,450,073 Q777K possibly damaging Het
Agpat4 G A 17: 12,210,377 probably null Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankle1 AT A 8: 71,407,207 probably benign Het
Ankrd44 T G 1: 54,766,748 probably benign Het
Aprt A T 8: 122,575,415 probably null Het
Aptx T C 4: 40,702,766 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Cacng7 T A 7: 3,336,691 M36K probably benign Het
Camta1 A G 4: 151,084,827 W156R probably damaging Het
Casd1 G A 6: 4,631,165 probably null Het
Casz1 T A 4: 148,933,267 Y338N probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cit A G 5: 115,994,087 T1801A probably benign Het
Cnot2 A G 10: 116,499,418 I275T probably damaging Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dst T C 1: 34,169,856 L820P probably damaging Het
Dusp11 T A 6: 85,950,055 N193Y probably damaging Het
Eif3m A T 2: 105,013,288 N116K probably benign Het
Epb41l1 A T 2: 156,509,261 E418D possibly damaging Het
Esyt2 T G 12: 116,318,890 N153K probably damaging Het
Exoc6b T G 6: 85,003,159 probably benign Het
Ezr C T 17: 6,739,722 E502K possibly damaging Het
Fbxw11 T A 11: 32,711,859 Y66N possibly damaging Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Fry T C 5: 150,386,104 L671P probably damaging Het
Galnt7 A G 8: 57,545,769 I262T probably damaging Het
Glp1r T C 17: 30,931,247 F381S probably benign Het
Gm3867 T C 9: 36,257,271 noncoding transcript Het
Gm5662 T C 12: 88,271,774 N72S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gstm7 G A 3: 107,926,919 T206I possibly damaging Het
Hist1h2bf A T 13: 23,574,057 V45E possibly damaging Het
Hs3st5 A T 10: 36,828,806 D35V probably benign Het
Hspa13 T C 16: 75,761,302 H125R probably benign Het
Hspa1a T G 17: 34,971,180 H249P probably damaging Het
Igkv10-95 A T 6: 68,680,578 Q6L probably damaging Het
Il1rap T A 16: 26,714,776 L474H probably benign Het
Ipo11 T A 13: 106,879,737 Y489F probably benign Het
Itga5 A G 15: 103,350,832 Y723H probably damaging Het
Itih2 T C 2: 10,105,160 N594S probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Kif26b A G 1: 178,679,355 Y332C probably damaging Het
Kmt2c G A 5: 25,354,384 R1086W probably damaging Het
Ktn1 T A 14: 47,726,179 probably benign Het
Lars2 T A 9: 123,418,693 I305N probably damaging Het
Lgmn G T 12: 102,400,124 probably benign Het
Ltbp4 C T 7: 27,306,700 E1453K probably damaging Het
Lypd8 G A 11: 58,386,849 M152I probably benign Het
Man2a1 T A 17: 64,712,459 S773T probably benign Het
Map2k6 T G 11: 110,499,474 L278R probably damaging Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mms19 A G 19: 41,945,496 V811A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtcl1 T A 17: 66,377,887 H520L probably benign Het
Mymk A T 2: 27,062,707 F130I probably damaging Het
Myo1f C T 17: 33,582,332 R333C probably damaging Het
Myo9a T A 9: 59,871,882 H1640Q probably benign Het
Nav1 A G 1: 135,592,448 probably benign Het
Ncbp3 G T 11: 73,079,018 G564C probably damaging Het
Ncoa4 A T 14: 32,176,725 I501L probably benign Het
Ngp T A 9: 110,420,815 N60K possibly damaging Het
Npc1l1 G T 11: 6,228,215 D398E probably damaging Het
Nphs2 T A 1: 156,326,131 M264K probably damaging Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr58 T A 9: 19,783,146 Y4* probably null Het
Patz1 A G 11: 3,306,241 Y509C probably damaging Het
Pax8 G A 2: 24,421,583 P447S probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Pex11g C T 8: 3,465,899 V45M probably benign Het
Pik3ip1 T A 11: 3,333,327 S142R probably damaging Het
Pitpnm2 C G 5: 124,125,371 A819P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plin4 T A 17: 56,105,418 M538L probably benign Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rngtt T A 4: 33,339,133 probably benign Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgsm1 A T 5: 113,255,307 F958Y probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorl1 C T 9: 42,031,914 V889M possibly damaging Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stam A T 2: 14,115,858 H53L probably damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tarbp1 A G 8: 126,474,330 Y246H probably damaging Het
Tbx15 A G 3: 99,352,367 Y518C probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tescl T C 7: 24,333,258 E214G probably damaging Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tmem132d A G 5: 127,984,296 V414A probably benign Het
Tmem41b T A 7: 109,974,734 probably benign Het
Tnfrsf18 A G 4: 156,021,880 probably benign Het
Tulp4 T A 17: 6,198,833 D42E probably damaging Het
Ubtd1 A G 19: 42,033,664 N125S probably damaging Het
Ubxn4 T A 1: 128,255,449 F68I probably benign Het
Urb1 A G 16: 90,776,271 S958P probably benign Het
Vash2 T C 1: 190,960,301 S226G probably benign Het
Vmn2r120 C T 17: 57,509,120 G745E probably damaging Het
Vmn2r58 T A 7: 41,837,693 I593F probably benign Het
Zfp398 T C 6: 47,840,427 L67P probably damaging Het
Zfp607b T A 7: 27,703,695 H525Q probably damaging Het
Zfp629 T C 7: 127,612,320 T106A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zic5 T A 14: 122,464,800 D173V probably damaging Het
Zranb2 G A 3: 157,541,884 probably benign Het
Other mutations in Rev1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Rev1 APN 1 38098940 missense probably damaging 1.00
IGL01065:Rev1 APN 1 38099009 missense possibly damaging 0.89
IGL01393:Rev1 APN 1 38092063 missense probably damaging 1.00
IGL03003:Rev1 APN 1 38088073 missense possibly damaging 0.77
H8562:Rev1 UTSW 1 38056767 missense probably damaging 0.96
PIT1430001:Rev1 UTSW 1 38056256 unclassified probably benign
R0409:Rev1 UTSW 1 38074368 nonsense probably null
R0606:Rev1 UTSW 1 38059123 missense probably null 1.00
R1134:Rev1 UTSW 1 38057687 missense probably benign 0.04
R1171:Rev1 UTSW 1 38088500 missense possibly damaging 0.89
R1208:Rev1 UTSW 1 38059118 unclassified probably benign
R1440:Rev1 UTSW 1 38088205 missense probably damaging 1.00
R1485:Rev1 UTSW 1 38088572 missense probably benign 0.00
R1627:Rev1 UTSW 1 38055490 missense probably damaging 0.99
R3845:Rev1 UTSW 1 38098988 missense probably damaging 0.99
R3948:Rev1 UTSW 1 38074333 missense possibly damaging 0.69
R4074:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4075:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4076:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4248:Rev1 UTSW 1 38107648 missense possibly damaging 0.87
R4293:Rev1 UTSW 1 38108419 missense possibly damaging 0.89
R4548:Rev1 UTSW 1 38059194 missense possibly damaging 0.72
R4654:Rev1 UTSW 1 38079256 intron probably benign
R5032:Rev1 UTSW 1 38074489 intron probably benign
R5286:Rev1 UTSW 1 38055326 nonsense probably null
R5311:Rev1 UTSW 1 38079393 missense probably benign 0.00
R5327:Rev1 UTSW 1 38108451 nonsense probably null
R6363:Rev1 UTSW 1 38071489 missense probably damaging 1.00
R7050:Rev1 UTSW 1 38054271 missense probably damaging 1.00
R7072:Rev1 UTSW 1 38067545 nonsense probably null
R7132:Rev1 UTSW 1 38071449 missense possibly damaging 0.95
R7264:Rev1 UTSW 1 38085601 missense probably damaging 1.00
R7298:Rev1 UTSW 1 38053104 missense probably damaging 1.00
R7367:Rev1 UTSW 1 38074407 nonsense probably null
R7395:Rev1 UTSW 1 38088065 missense possibly damaging 0.69
R7829:Rev1 UTSW 1 38056445 missense probably damaging 0.98
X0017:Rev1 UTSW 1 38053661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGTCACTTGTGTATTGGAC -3'
(R):5'- TAGCTCTGTGATTCGAGAACAGG -3'

Sequencing Primer
(F):5'- GTGTATTGGACATATAACCATGGG -3'
(R):5'- CTCTGTGATTCGAGAACAGGACCTG -3'
Posted On2015-09-25