Incidental Mutation 'R4610:Pax8'
ID 344571
Institutional Source Beutler Lab
Gene Symbol Pax8
Ensembl Gene ENSMUSG00000026976
Gene Name paired box 8
Synonyms Pax-8
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4610 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 24310572-24365611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24311595 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 447 (P447S)
Ref Sequence ENSEMBL: ENSMUSP00000028355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028355] [ENSMUST00000149294] [ENSMUST00000153601]
AlphaFold Q00288
Predicted Effect probably damaging
Transcript: ENSMUST00000028355
AA Change: P447S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028355
Gene: ENSMUSG00000026976
AA Change: P447S

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 8e-5 SMART
low complexity region 311 328 N/A INTRINSIC
Pfam:Pax2_C 344 456 2.3e-57 PFAM
Predicted Effect silent
Transcript: ENSMUST00000149294
SMART Domains Protein: ENSMUSP00000115194
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149860
Predicted Effect probably benign
Transcript: ENSMUST00000153601
SMART Domains Protein: ENSMUSP00000134343
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
SCOP:d1ftt__ 23 49 1e-4 SMART
Meta Mutation Damage Score 0.1683 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors that contain a characteristic N-terminal paired DNA-binding domain. The encoded protein is important for proper differentiation of the thyroid and the kidney. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit severe hypothyroidism due to thyroid follicular cell aplasia, male infertility, deafness, ataxia, growth retardation, tiny spleens, impaired ossification of long bones and maturation of the small intestine, fatty livers, and lethality around weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Adgre1 C A 17: 57,757,073 (GRCm39) Q777K possibly damaging Het
Agpat4 G A 17: 12,429,264 (GRCm39) probably null Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Ankle1 AT A 8: 71,859,851 (GRCm39) probably benign Het
Ankrd44 T G 1: 54,805,907 (GRCm39) probably benign Het
Aprt A T 8: 123,302,154 (GRCm39) probably null Het
Aptx T C 4: 40,702,766 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Cacng7 T A 7: 3,385,207 (GRCm39) M36K probably benign Het
Camta1 A G 4: 151,169,284 (GRCm39) W156R probably damaging Het
Casd1 G A 6: 4,631,165 (GRCm39) probably null Het
Casz1 T A 4: 149,017,724 (GRCm39) Y338N probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cit A G 5: 116,132,146 (GRCm39) T1801A probably benign Het
Cnot2 A G 10: 116,335,323 (GRCm39) I275T probably damaging Het
Ddx4 T C 13: 112,748,594 (GRCm39) K435E probably damaging Het
Dnajc6 T C 4: 101,468,461 (GRCm39) F166L probably damaging Het
Dst T C 1: 34,208,937 (GRCm39) L820P probably damaging Het
Dusp11 T A 6: 85,927,037 (GRCm39) N193Y probably damaging Het
Eif1ad7 T C 12: 88,238,544 (GRCm39) N72S probably benign Het
Eif3m A T 2: 104,843,633 (GRCm39) N116K probably benign Het
Epb41l1 A T 2: 156,351,181 (GRCm39) E418D possibly damaging Het
Esyt2 T G 12: 116,282,510 (GRCm39) N153K probably damaging Het
Exoc6b T G 6: 84,980,141 (GRCm39) probably benign Het
Ezr C T 17: 7,007,121 (GRCm39) E502K possibly damaging Het
Fbxw11 T A 11: 32,661,859 (GRCm39) Y66N possibly damaging Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Fry T C 5: 150,309,569 (GRCm39) L671P probably damaging Het
Galnt7 A G 8: 57,998,803 (GRCm39) I262T probably damaging Het
Glp1r T C 17: 31,150,221 (GRCm39) F381S probably benign Het
Gm3867 T C 9: 36,168,567 (GRCm39) noncoding transcript Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Gp1bb A T 16: 18,439,893 (GRCm39) L67Q probably damaging Het
Gstm7 G A 3: 107,834,235 (GRCm39) T206I possibly damaging Het
H2bc7 A T 13: 23,758,231 (GRCm39) V45E possibly damaging Het
Hs3st5 A T 10: 36,704,802 (GRCm39) D35V probably benign Het
Hspa13 T C 16: 75,558,190 (GRCm39) H125R probably benign Het
Hspa1a T G 17: 35,190,156 (GRCm39) H249P probably damaging Het
Igkv10-95 A T 6: 68,657,562 (GRCm39) Q6L probably damaging Het
Il1rap T A 16: 26,533,526 (GRCm39) L474H probably benign Het
Ipo11 T A 13: 107,016,245 (GRCm39) Y489F probably benign Het
Itga5 A G 15: 103,259,259 (GRCm39) Y723H probably damaging Het
Itih2 T C 2: 10,109,971 (GRCm39) N594S probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Kif26b A G 1: 178,506,920 (GRCm39) Y332C probably damaging Het
Kmt2c G A 5: 25,559,382 (GRCm39) R1086W probably damaging Het
Ktn1 T A 14: 47,963,636 (GRCm39) probably benign Het
Lars2 T A 9: 123,247,758 (GRCm39) I305N probably damaging Het
Lgmn G T 12: 102,366,383 (GRCm39) probably benign Het
Ltbp4 C T 7: 27,006,125 (GRCm39) E1453K probably damaging Het
Lypd8 G A 11: 58,277,675 (GRCm39) M152I probably benign Het
Man2a1 T A 17: 65,019,454 (GRCm39) S773T probably benign Het
Map2k6 T G 11: 110,390,300 (GRCm39) L278R probably damaging Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mms19 A G 19: 41,933,935 (GRCm39) V811A possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl1 T A 17: 66,684,882 (GRCm39) H520L probably benign Het
Mymk A T 2: 26,952,719 (GRCm39) F130I probably damaging Het
Myo1f C T 17: 33,801,306 (GRCm39) R333C probably damaging Het
Myo9a T A 9: 59,779,165 (GRCm39) H1640Q probably benign Het
Nav1 A G 1: 135,520,186 (GRCm39) probably benign Het
Ncbp3 G T 11: 72,969,844 (GRCm39) G564C probably damaging Het
Ncoa4 A T 14: 31,898,682 (GRCm39) I501L probably benign Het
Ngp T A 9: 110,249,883 (GRCm39) N60K possibly damaging Het
Npc1l1 G T 11: 6,178,215 (GRCm39) D398E probably damaging Het
Nphs2 T A 1: 156,153,701 (GRCm39) M264K probably damaging Het
Or4s2b G A 2: 88,508,240 (GRCm39) V14I probably benign Het
Or4s2b T G 2: 88,508,523 (GRCm39) V101G probably benign Het
Or7e165 T A 9: 19,694,442 (GRCm39) Y4* probably null Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Patz1 A G 11: 3,256,241 (GRCm39) Y509C probably damaging Het
Pde11a A G 2: 75,988,677 (GRCm39) V488A probably benign Het
Pex11g C T 8: 3,515,899 (GRCm39) V45M probably benign Het
Pik3ip1 T A 11: 3,283,327 (GRCm39) S142R probably damaging Het
Pitpnm2 C G 5: 124,263,434 (GRCm39) A819P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plin4 T A 17: 56,412,418 (GRCm39) M538L probably benign Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rev1 T C 1: 38,092,730 (GRCm39) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm39) probably benign Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Sgsm1 A T 5: 113,403,173 (GRCm39) F958Y probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorl1 C T 9: 41,943,210 (GRCm39) V889M possibly damaging Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Stam A T 2: 14,120,669 (GRCm39) H53L probably damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tarbp1 A G 8: 127,201,069 (GRCm39) Y246H probably damaging Het
Tbx15 A G 3: 99,259,683 (GRCm39) Y518C probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tescl T C 7: 24,032,683 (GRCm39) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tmem132d A G 5: 128,061,360 (GRCm39) V414A probably benign Het
Tmem41b T A 7: 109,573,941 (GRCm39) probably benign Het
Tnfrsf18 A G 4: 156,106,337 (GRCm39) probably benign Het
Tulp4 T A 17: 6,249,108 (GRCm39) D42E probably damaging Het
Ubtd1 A G 19: 42,022,103 (GRCm39) N125S probably damaging Het
Ubxn4 T A 1: 128,183,186 (GRCm39) F68I probably benign Het
Urb1 A G 16: 90,573,159 (GRCm39) S958P probably benign Het
Vash2 T C 1: 190,692,498 (GRCm39) S226G probably benign Het
Vmn2r120 C T 17: 57,816,120 (GRCm39) G745E probably damaging Het
Vmn2r58 T A 7: 41,487,117 (GRCm39) I593F probably benign Het
Zfp398 T C 6: 47,817,361 (GRCm39) L67P probably damaging Het
Zfp607b T A 7: 27,403,120 (GRCm39) H525Q probably damaging Het
Zfp629 T C 7: 127,211,492 (GRCm39) T106A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zic5 T A 14: 122,702,212 (GRCm39) D173V probably damaging Het
Zranb2 G A 3: 157,247,521 (GRCm39) probably benign Het
Other mutations in Pax8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Pax8 APN 2 24,333,144 (GRCm39) missense probably damaging 1.00
IGL01118:Pax8 APN 2 24,332,944 (GRCm39) splice site probably benign
IGL01141:Pax8 APN 2 24,331,162 (GRCm39) missense probably damaging 1.00
IGL01338:Pax8 APN 2 24,325,931 (GRCm39) missense possibly damaging 0.93
IGL01801:Pax8 APN 2 24,334,576 (GRCm39) critical splice donor site probably null
IGL02159:Pax8 APN 2 24,330,800 (GRCm39) missense possibly damaging 0.56
IGL02727:Pax8 APN 2 24,331,642 (GRCm39) missense probably damaging 0.98
IGL02887:Pax8 APN 2 24,334,627 (GRCm39) missense probably damaging 1.00
IGL03134:Pax8 UTSW 2 24,311,403 (GRCm39) unclassified probably benign
R1499:Pax8 UTSW 2 24,319,608 (GRCm39) missense possibly damaging 0.92
R1756:Pax8 UTSW 2 24,325,833 (GRCm39) missense probably damaging 0.98
R2051:Pax8 UTSW 2 24,326,520 (GRCm39) missense probably benign
R2234:Pax8 UTSW 2 24,333,114 (GRCm39) missense probably damaging 1.00
R2289:Pax8 UTSW 2 24,330,752 (GRCm39) missense probably benign 0.00
R2306:Pax8 UTSW 2 24,333,057 (GRCm39) missense probably damaging 1.00
R4328:Pax8 UTSW 2 24,331,663 (GRCm39) missense possibly damaging 0.92
R4434:Pax8 UTSW 2 24,319,621 (GRCm39) missense possibly damaging 0.93
R4592:Pax8 UTSW 2 24,333,201 (GRCm39) intron probably benign
R4873:Pax8 UTSW 2 24,331,652 (GRCm39) missense probably benign 0.04
R4875:Pax8 UTSW 2 24,331,652 (GRCm39) missense probably benign 0.04
R5394:Pax8 UTSW 2 24,332,922 (GRCm39) intron probably benign
R5924:Pax8 UTSW 2 24,311,634 (GRCm39) missense probably damaging 0.97
R6796:Pax8 UTSW 2 24,331,098 (GRCm39) missense probably benign 0.04
R7658:Pax8 UTSW 2 24,326,523 (GRCm39) missense probably benign 0.00
R7660:Pax8 UTSW 2 24,326,573 (GRCm39) missense probably benign
R7690:Pax8 UTSW 2 24,331,682 (GRCm39) missense probably benign 0.37
R7775:Pax8 UTSW 2 24,325,913 (GRCm39) missense possibly damaging 0.93
R7793:Pax8 UTSW 2 24,319,609 (GRCm39) missense possibly damaging 0.85
R7824:Pax8 UTSW 2 24,325,913 (GRCm39) missense possibly damaging 0.93
R7859:Pax8 UTSW 2 24,311,567 (GRCm39) missense possibly damaging 0.93
R8225:Pax8 UTSW 2 24,312,983 (GRCm39) missense probably damaging 0.99
R8520:Pax8 UTSW 2 24,333,034 (GRCm39) missense probably damaging 1.00
R9651:Pax8 UTSW 2 24,331,173 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTTGGCCTTCTCCAAG -3'
(R):5'- ATCTTTGATGATCAGATGGGCG -3'

Sequencing Primer
(F):5'- AAGGTCATCCTGACTTTCATGG -3'
(R):5'- CGTGGGGGATAAATGATTAACTTG -3'
Posted On 2015-09-25