Incidental Mutation 'R4610:Dnajc6'
ID 344586
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene Name DnaJ heat shock protein family (Hsp40) member C6
Synonyms auxilin, 2810027M23Rik
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R4610 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 101353828-101499996 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101468461 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 166 (F166L)
Ref Sequence ENSEMBL: ENSMUSP00000102543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933] [ENSMUST00000149047] [ENSMUST00000154120]
AlphaFold Q80TZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000038207
AA Change: F204L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: F204L

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094953
AA Change: F166L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: F166L

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106929
AA Change: F166L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: F166L

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106930
AA Change: F166L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: F166L

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106933
AA Change: F234L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: F234L

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149047
AA Change: F166L

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000119542
Gene: ENSMUSG00000028528
AA Change: F166L

DomainStartEndE-ValueType
PDB:3N0A|A 30 194 1e-118 PDB
SCOP:d1d5ra2 50 187 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154120
SMART Domains Protein: ENSMUSP00000114840
Gene: ENSMUSG00000028528

DomainStartEndE-ValueType
PDB:3N0A|A 30 116 4e-54 PDB
SCOP:d1d5ra2 50 101 1e-4 SMART
Meta Mutation Damage Score 0.1234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Adgre1 C A 17: 57,757,073 (GRCm39) Q777K possibly damaging Het
Agpat4 G A 17: 12,429,264 (GRCm39) probably null Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Ankle1 AT A 8: 71,859,851 (GRCm39) probably benign Het
Ankrd44 T G 1: 54,805,907 (GRCm39) probably benign Het
Aprt A T 8: 123,302,154 (GRCm39) probably null Het
Aptx T C 4: 40,702,766 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Cacng7 T A 7: 3,385,207 (GRCm39) M36K probably benign Het
Camta1 A G 4: 151,169,284 (GRCm39) W156R probably damaging Het
Casd1 G A 6: 4,631,165 (GRCm39) probably null Het
Casz1 T A 4: 149,017,724 (GRCm39) Y338N probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cit A G 5: 116,132,146 (GRCm39) T1801A probably benign Het
Cnot2 A G 10: 116,335,323 (GRCm39) I275T probably damaging Het
Ddx4 T C 13: 112,748,594 (GRCm39) K435E probably damaging Het
Dst T C 1: 34,208,937 (GRCm39) L820P probably damaging Het
Dusp11 T A 6: 85,927,037 (GRCm39) N193Y probably damaging Het
Eif1ad7 T C 12: 88,238,544 (GRCm39) N72S probably benign Het
Eif3m A T 2: 104,843,633 (GRCm39) N116K probably benign Het
Epb41l1 A T 2: 156,351,181 (GRCm39) E418D possibly damaging Het
Esyt2 T G 12: 116,282,510 (GRCm39) N153K probably damaging Het
Exoc6b T G 6: 84,980,141 (GRCm39) probably benign Het
Ezr C T 17: 7,007,121 (GRCm39) E502K possibly damaging Het
Fbxw11 T A 11: 32,661,859 (GRCm39) Y66N possibly damaging Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Fry T C 5: 150,309,569 (GRCm39) L671P probably damaging Het
Galnt7 A G 8: 57,998,803 (GRCm39) I262T probably damaging Het
Glp1r T C 17: 31,150,221 (GRCm39) F381S probably benign Het
Gm3867 T C 9: 36,168,567 (GRCm39) noncoding transcript Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Gp1bb A T 16: 18,439,893 (GRCm39) L67Q probably damaging Het
Gstm7 G A 3: 107,834,235 (GRCm39) T206I possibly damaging Het
H2bc7 A T 13: 23,758,231 (GRCm39) V45E possibly damaging Het
Hs3st5 A T 10: 36,704,802 (GRCm39) D35V probably benign Het
Hspa13 T C 16: 75,558,190 (GRCm39) H125R probably benign Het
Hspa1a T G 17: 35,190,156 (GRCm39) H249P probably damaging Het
Igkv10-95 A T 6: 68,657,562 (GRCm39) Q6L probably damaging Het
Il1rap T A 16: 26,533,526 (GRCm39) L474H probably benign Het
Ipo11 T A 13: 107,016,245 (GRCm39) Y489F probably benign Het
Itga5 A G 15: 103,259,259 (GRCm39) Y723H probably damaging Het
Itih2 T C 2: 10,109,971 (GRCm39) N594S probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Kif26b A G 1: 178,506,920 (GRCm39) Y332C probably damaging Het
Kmt2c G A 5: 25,559,382 (GRCm39) R1086W probably damaging Het
Ktn1 T A 14: 47,963,636 (GRCm39) probably benign Het
Lars2 T A 9: 123,247,758 (GRCm39) I305N probably damaging Het
Lgmn G T 12: 102,366,383 (GRCm39) probably benign Het
Ltbp4 C T 7: 27,006,125 (GRCm39) E1453K probably damaging Het
Lypd8 G A 11: 58,277,675 (GRCm39) M152I probably benign Het
Man2a1 T A 17: 65,019,454 (GRCm39) S773T probably benign Het
Map2k6 T G 11: 110,390,300 (GRCm39) L278R probably damaging Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mms19 A G 19: 41,933,935 (GRCm39) V811A possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl1 T A 17: 66,684,882 (GRCm39) H520L probably benign Het
Mymk A T 2: 26,952,719 (GRCm39) F130I probably damaging Het
Myo1f C T 17: 33,801,306 (GRCm39) R333C probably damaging Het
Myo9a T A 9: 59,779,165 (GRCm39) H1640Q probably benign Het
Nav1 A G 1: 135,520,186 (GRCm39) probably benign Het
Ncbp3 G T 11: 72,969,844 (GRCm39) G564C probably damaging Het
Ncoa4 A T 14: 31,898,682 (GRCm39) I501L probably benign Het
Ngp T A 9: 110,249,883 (GRCm39) N60K possibly damaging Het
Npc1l1 G T 11: 6,178,215 (GRCm39) D398E probably damaging Het
Nphs2 T A 1: 156,153,701 (GRCm39) M264K probably damaging Het
Or4s2b G A 2: 88,508,240 (GRCm39) V14I probably benign Het
Or4s2b T G 2: 88,508,523 (GRCm39) V101G probably benign Het
Or7e165 T A 9: 19,694,442 (GRCm39) Y4* probably null Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Patz1 A G 11: 3,256,241 (GRCm39) Y509C probably damaging Het
Pax8 G A 2: 24,311,595 (GRCm39) P447S probably damaging Het
Pde11a A G 2: 75,988,677 (GRCm39) V488A probably benign Het
Pex11g C T 8: 3,515,899 (GRCm39) V45M probably benign Het
Pik3ip1 T A 11: 3,283,327 (GRCm39) S142R probably damaging Het
Pitpnm2 C G 5: 124,263,434 (GRCm39) A819P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plin4 T A 17: 56,412,418 (GRCm39) M538L probably benign Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rev1 T C 1: 38,092,730 (GRCm39) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm39) probably benign Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Sgsm1 A T 5: 113,403,173 (GRCm39) F958Y probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorl1 C T 9: 41,943,210 (GRCm39) V889M possibly damaging Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Stam A T 2: 14,120,669 (GRCm39) H53L probably damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tarbp1 A G 8: 127,201,069 (GRCm39) Y246H probably damaging Het
Tbx15 A G 3: 99,259,683 (GRCm39) Y518C probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tescl T C 7: 24,032,683 (GRCm39) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tmem132d A G 5: 128,061,360 (GRCm39) V414A probably benign Het
Tmem41b T A 7: 109,573,941 (GRCm39) probably benign Het
Tnfrsf18 A G 4: 156,106,337 (GRCm39) probably benign Het
Tulp4 T A 17: 6,249,108 (GRCm39) D42E probably damaging Het
Ubtd1 A G 19: 42,022,103 (GRCm39) N125S probably damaging Het
Ubxn4 T A 1: 128,183,186 (GRCm39) F68I probably benign Het
Urb1 A G 16: 90,573,159 (GRCm39) S958P probably benign Het
Vash2 T C 1: 190,692,498 (GRCm39) S226G probably benign Het
Vmn2r120 C T 17: 57,816,120 (GRCm39) G745E probably damaging Het
Vmn2r58 T A 7: 41,487,117 (GRCm39) I593F probably benign Het
Zfp398 T C 6: 47,817,361 (GRCm39) L67P probably damaging Het
Zfp607b T A 7: 27,403,120 (GRCm39) H525Q probably damaging Het
Zfp629 T C 7: 127,211,492 (GRCm39) T106A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zic5 T A 14: 122,702,212 (GRCm39) D173V probably damaging Het
Zranb2 G A 3: 157,247,521 (GRCm39) probably benign Het
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101,365,286 (GRCm39) intron probably benign
IGL02336:Dnajc6 APN 4 101,471,483 (GRCm39) splice site probably null
IGL02551:Dnajc6 APN 4 101,496,550 (GRCm39) missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101,455,010 (GRCm39) missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101,496,497 (GRCm39) missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101,474,057 (GRCm39) missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101,365,274 (GRCm39) intron probably benign
R0091:Dnajc6 UTSW 4 101,473,974 (GRCm39) splice site probably benign
R0384:Dnajc6 UTSW 4 101,456,153 (GRCm39) missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101,492,388 (GRCm39) missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101,468,450 (GRCm39) missense possibly damaging 0.91
R1239:Dnajc6 UTSW 4 101,492,313 (GRCm39) missense probably damaging 0.98
R1421:Dnajc6 UTSW 4 101,468,513 (GRCm39) missense probably damaging 0.97
R1424:Dnajc6 UTSW 4 101,496,544 (GRCm39) missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101,456,334 (GRCm39) missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101,456,364 (GRCm39) missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101,455,028 (GRCm39) missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101,456,185 (GRCm39) missense probably damaging 1.00
R2032:Dnajc6 UTSW 4 101,471,435 (GRCm39) missense probably benign 0.39
R2518:Dnajc6 UTSW 4 101,470,127 (GRCm39) missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101,474,054 (GRCm39) missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101,496,593 (GRCm39) missense probably damaging 1.00
R4601:Dnajc6 UTSW 4 101,468,461 (GRCm39) missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101,468,461 (GRCm39) missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101,407,996 (GRCm39) missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101,456,231 (GRCm39) intron probably benign
R4938:Dnajc6 UTSW 4 101,494,010 (GRCm39) missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101,472,824 (GRCm39) missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101,485,355 (GRCm39) critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101,463,807 (GRCm39) missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101,475,839 (GRCm39) missense probably benign 0.39
R6044:Dnajc6 UTSW 4 101,473,774 (GRCm39) missense probably benign 0.22
R6086:Dnajc6 UTSW 4 101,455,004 (GRCm39) missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101,472,795 (GRCm39) missense probably damaging 1.00
R6495:Dnajc6 UTSW 4 101,492,262 (GRCm39) nonsense probably null
R6956:Dnajc6 UTSW 4 101,471,470 (GRCm39) missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101,472,812 (GRCm39) missense probably damaging 1.00
R7155:Dnajc6 UTSW 4 101,470,142 (GRCm39) missense probably damaging 1.00
R7192:Dnajc6 UTSW 4 101,455,000 (GRCm39) missense probably benign 0.02
R7226:Dnajc6 UTSW 4 101,496,569 (GRCm39) missense probably damaging 1.00
R7298:Dnajc6 UTSW 4 101,463,808 (GRCm39) missense probably benign 0.09
R7612:Dnajc6 UTSW 4 101,455,123 (GRCm39) missense probably benign 0.40
R7622:Dnajc6 UTSW 4 101,497,688 (GRCm39) missense probably damaging 1.00
R7652:Dnajc6 UTSW 4 101,463,874 (GRCm39) missense probably damaging 0.98
R7789:Dnajc6 UTSW 4 101,475,729 (GRCm39) missense possibly damaging 0.82
R8010:Dnajc6 UTSW 4 101,475,611 (GRCm39) missense probably benign 0.01
R8201:Dnajc6 UTSW 4 101,475,960 (GRCm39) missense probably benign 0.08
R8305:Dnajc6 UTSW 4 101,480,984 (GRCm39) missense probably damaging 1.00
R8912:Dnajc6 UTSW 4 101,468,513 (GRCm39) missense probably damaging 1.00
R9012:Dnajc6 UTSW 4 101,470,156 (GRCm39) missense probably damaging 1.00
R9052:Dnajc6 UTSW 4 101,496,617 (GRCm39) missense probably damaging 0.97
R9091:Dnajc6 UTSW 4 101,496,559 (GRCm39) missense possibly damaging 0.80
R9160:Dnajc6 UTSW 4 101,470,258 (GRCm39) unclassified probably benign
R9258:Dnajc6 UTSW 4 101,475,813 (GRCm39) missense probably benign 0.07
R9270:Dnajc6 UTSW 4 101,496,559 (GRCm39) missense possibly damaging 0.80
R9294:Dnajc6 UTSW 4 101,408,054 (GRCm39) critical splice donor site probably null
R9386:Dnajc6 UTSW 4 101,494,098 (GRCm39) critical splice donor site probably null
R9664:Dnajc6 UTSW 4 101,475,821 (GRCm39) missense probably benign 0.04
Z1088:Dnajc6 UTSW 4 101,496,526 (GRCm39) missense probably damaging 1.00
Z1177:Dnajc6 UTSW 4 101,496,625 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCAAGTAGAATTTGTTTTCCTGAGC -3'
(R):5'- ATCATAGTTCAGGATAACAGCAACC -3'

Sequencing Primer
(F):5'- AAAAGTCTTTCCTTGATGCTTTGTG -3'
(R):5'- GTTCAGGATAACAGCAACCAATTAG -3'
Posted On 2015-09-25