Incidental Mutation 'R4610:Camta1'
ID 344589
Institutional Source Beutler Lab
Gene Symbol Camta1
Ensembl Gene ENSMUSG00000014592
Gene Name calmodulin binding transcription activator 1
Synonyms 2310058O09Rik, 1810059M14Rik
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.551) question?
Stock # R4610 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 151143980-151946225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 151169284 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 156 (W156R)
Ref Sequence ENSEMBL: ENSMUSP00000101293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000105667] [ENSMUST00000105668] [ENSMUST00000105670] [ENSMUST00000131948] [ENSMUST00000169423]
AlphaFold A2A891
Predicted Effect probably damaging
Transcript: ENSMUST00000049790
AA Change: W1134R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: W1134R

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3e-13 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097774
AA Change: W1134R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: W1134R

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1570 5.45e1 SMART
IQ 1571 1593 5.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105667
Predicted Effect probably damaging
Transcript: ENSMUST00000105668
AA Change: W156R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101293
Gene: ENSMUSG00000014592
AA Change: W156R

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
ANK 88 117 1.7e2 SMART
ANK 133 163 4.73e2 SMART
Blast:ANK 167 197 6e-10 BLAST
IQ 457 473 2.38e2 SMART
IQ 487 509 5.42e0 SMART
Pfam:IQ 512 527 5.1e-4 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105670
AA Change: W156R

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101295
Gene: ENSMUSG00000014592
AA Change: W156R

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
ANK 88 117 1.7e2 SMART
ANK 133 163 4.73e2 SMART
Blast:ANK 167 197 5e-10 BLAST
IQ 457 479 5.45e1 SMART
IQ 480 502 5.42e0 SMART
Pfam:IQ 505 520 5.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131948
SMART Domains Protein: ENSMUSP00000118969
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143434
Predicted Effect probably damaging
Transcript: ENSMUST00000169423
AA Change: W1134R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: W1134R

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Meta Mutation Damage Score 0.7580 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Adgre1 C A 17: 57,757,073 (GRCm39) Q777K possibly damaging Het
Agpat4 G A 17: 12,429,264 (GRCm39) probably null Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Ankle1 AT A 8: 71,859,851 (GRCm39) probably benign Het
Ankrd44 T G 1: 54,805,907 (GRCm39) probably benign Het
Aprt A T 8: 123,302,154 (GRCm39) probably null Het
Aptx T C 4: 40,702,766 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Cacng7 T A 7: 3,385,207 (GRCm39) M36K probably benign Het
Casd1 G A 6: 4,631,165 (GRCm39) probably null Het
Casz1 T A 4: 149,017,724 (GRCm39) Y338N probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cit A G 5: 116,132,146 (GRCm39) T1801A probably benign Het
Cnot2 A G 10: 116,335,323 (GRCm39) I275T probably damaging Het
Ddx4 T C 13: 112,748,594 (GRCm39) K435E probably damaging Het
Dnajc6 T C 4: 101,468,461 (GRCm39) F166L probably damaging Het
Dst T C 1: 34,208,937 (GRCm39) L820P probably damaging Het
Dusp11 T A 6: 85,927,037 (GRCm39) N193Y probably damaging Het
Eif1ad7 T C 12: 88,238,544 (GRCm39) N72S probably benign Het
Eif3m A T 2: 104,843,633 (GRCm39) N116K probably benign Het
Epb41l1 A T 2: 156,351,181 (GRCm39) E418D possibly damaging Het
Esyt2 T G 12: 116,282,510 (GRCm39) N153K probably damaging Het
Exoc6b T G 6: 84,980,141 (GRCm39) probably benign Het
Ezr C T 17: 7,007,121 (GRCm39) E502K possibly damaging Het
Fbxw11 T A 11: 32,661,859 (GRCm39) Y66N possibly damaging Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Fry T C 5: 150,309,569 (GRCm39) L671P probably damaging Het
Galnt7 A G 8: 57,998,803 (GRCm39) I262T probably damaging Het
Glp1r T C 17: 31,150,221 (GRCm39) F381S probably benign Het
Gm3867 T C 9: 36,168,567 (GRCm39) noncoding transcript Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Gp1bb A T 16: 18,439,893 (GRCm39) L67Q probably damaging Het
Gstm7 G A 3: 107,834,235 (GRCm39) T206I possibly damaging Het
H2bc7 A T 13: 23,758,231 (GRCm39) V45E possibly damaging Het
Hs3st5 A T 10: 36,704,802 (GRCm39) D35V probably benign Het
Hspa13 T C 16: 75,558,190 (GRCm39) H125R probably benign Het
Hspa1a T G 17: 35,190,156 (GRCm39) H249P probably damaging Het
Igkv10-95 A T 6: 68,657,562 (GRCm39) Q6L probably damaging Het
Il1rap T A 16: 26,533,526 (GRCm39) L474H probably benign Het
Ipo11 T A 13: 107,016,245 (GRCm39) Y489F probably benign Het
Itga5 A G 15: 103,259,259 (GRCm39) Y723H probably damaging Het
Itih2 T C 2: 10,109,971 (GRCm39) N594S probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Kif26b A G 1: 178,506,920 (GRCm39) Y332C probably damaging Het
Kmt2c G A 5: 25,559,382 (GRCm39) R1086W probably damaging Het
Ktn1 T A 14: 47,963,636 (GRCm39) probably benign Het
Lars2 T A 9: 123,247,758 (GRCm39) I305N probably damaging Het
Lgmn G T 12: 102,366,383 (GRCm39) probably benign Het
Ltbp4 C T 7: 27,006,125 (GRCm39) E1453K probably damaging Het
Lypd8 G A 11: 58,277,675 (GRCm39) M152I probably benign Het
Man2a1 T A 17: 65,019,454 (GRCm39) S773T probably benign Het
Map2k6 T G 11: 110,390,300 (GRCm39) L278R probably damaging Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mms19 A G 19: 41,933,935 (GRCm39) V811A possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl1 T A 17: 66,684,882 (GRCm39) H520L probably benign Het
Mymk A T 2: 26,952,719 (GRCm39) F130I probably damaging Het
Myo1f C T 17: 33,801,306 (GRCm39) R333C probably damaging Het
Myo9a T A 9: 59,779,165 (GRCm39) H1640Q probably benign Het
Nav1 A G 1: 135,520,186 (GRCm39) probably benign Het
Ncbp3 G T 11: 72,969,844 (GRCm39) G564C probably damaging Het
Ncoa4 A T 14: 31,898,682 (GRCm39) I501L probably benign Het
Ngp T A 9: 110,249,883 (GRCm39) N60K possibly damaging Het
Npc1l1 G T 11: 6,178,215 (GRCm39) D398E probably damaging Het
Nphs2 T A 1: 156,153,701 (GRCm39) M264K probably damaging Het
Or4s2b G A 2: 88,508,240 (GRCm39) V14I probably benign Het
Or4s2b T G 2: 88,508,523 (GRCm39) V101G probably benign Het
Or7e165 T A 9: 19,694,442 (GRCm39) Y4* probably null Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Patz1 A G 11: 3,256,241 (GRCm39) Y509C probably damaging Het
Pax8 G A 2: 24,311,595 (GRCm39) P447S probably damaging Het
Pde11a A G 2: 75,988,677 (GRCm39) V488A probably benign Het
Pex11g C T 8: 3,515,899 (GRCm39) V45M probably benign Het
Pik3ip1 T A 11: 3,283,327 (GRCm39) S142R probably damaging Het
Pitpnm2 C G 5: 124,263,434 (GRCm39) A819P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plin4 T A 17: 56,412,418 (GRCm39) M538L probably benign Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rev1 T C 1: 38,092,730 (GRCm39) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm39) probably benign Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Sgsm1 A T 5: 113,403,173 (GRCm39) F958Y probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorl1 C T 9: 41,943,210 (GRCm39) V889M possibly damaging Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Stam A T 2: 14,120,669 (GRCm39) H53L probably damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tarbp1 A G 8: 127,201,069 (GRCm39) Y246H probably damaging Het
Tbx15 A G 3: 99,259,683 (GRCm39) Y518C probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tescl T C 7: 24,032,683 (GRCm39) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tmem132d A G 5: 128,061,360 (GRCm39) V414A probably benign Het
Tmem41b T A 7: 109,573,941 (GRCm39) probably benign Het
Tnfrsf18 A G 4: 156,106,337 (GRCm39) probably benign Het
Tulp4 T A 17: 6,249,108 (GRCm39) D42E probably damaging Het
Ubtd1 A G 19: 42,022,103 (GRCm39) N125S probably damaging Het
Ubxn4 T A 1: 128,183,186 (GRCm39) F68I probably benign Het
Urb1 A G 16: 90,573,159 (GRCm39) S958P probably benign Het
Vash2 T C 1: 190,692,498 (GRCm39) S226G probably benign Het
Vmn2r120 C T 17: 57,816,120 (GRCm39) G745E probably damaging Het
Vmn2r58 T A 7: 41,487,117 (GRCm39) I593F probably benign Het
Zfp398 T C 6: 47,817,361 (GRCm39) L67P probably damaging Het
Zfp607b T A 7: 27,403,120 (GRCm39) H525Q probably damaging Het
Zfp629 T C 7: 127,211,492 (GRCm39) T106A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zic5 T A 14: 122,702,212 (GRCm39) D173V probably damaging Het
Zranb2 G A 3: 157,247,521 (GRCm39) probably benign Het
Other mutations in Camta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Camta1 APN 4 151,155,881 (GRCm39) critical splice donor site probably null
IGL00823:Camta1 APN 4 151,169,058 (GRCm39) missense probably benign 0.02
IGL01361:Camta1 APN 4 151,229,149 (GRCm39) missense probably damaging 1.00
IGL01523:Camta1 APN 4 151,229,507 (GRCm39) missense possibly damaging 0.73
IGL01730:Camta1 APN 4 151,147,302 (GRCm39) missense probably damaging 0.99
IGL02045:Camta1 APN 4 151,158,442 (GRCm39) splice site probably null
IGL02541:Camta1 APN 4 151,169,112 (GRCm39) missense probably benign 0.12
IGL02839:Camta1 APN 4 151,228,969 (GRCm39) missense probably damaging 1.00
IGL03012:Camta1 APN 4 151,537,756 (GRCm39) missense probably damaging 1.00
Bonus UTSW 4 151,222,832 (GRCm39) missense probably damaging 1.00
BB010:Camta1 UTSW 4 151,168,214 (GRCm39) missense probably damaging 0.99
BB020:Camta1 UTSW 4 151,168,214 (GRCm39) missense probably damaging 0.99
PIT4449001:Camta1 UTSW 4 151,216,043 (GRCm39) missense probably benign 0.00
R0136:Camta1 UTSW 4 151,163,426 (GRCm39) missense probably damaging 0.99
R0239:Camta1 UTSW 4 151,228,187 (GRCm39) missense probably damaging 1.00
R0239:Camta1 UTSW 4 151,228,187 (GRCm39) missense probably damaging 1.00
R0276:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0346:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0347:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0348:Camta1 UTSW 4 151,670,888 (GRCm39) missense possibly damaging 0.64
R0385:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0386:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0388:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0410:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0456:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0478:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0510:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0511:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0683:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0724:Camta1 UTSW 4 151,162,349 (GRCm39) missense probably damaging 1.00
R0732:Camta1 UTSW 4 151,670,941 (GRCm39) critical splice acceptor site probably null
R1549:Camta1 UTSW 4 151,670,920 (GRCm39) missense probably damaging 1.00
R1670:Camta1 UTSW 4 151,164,228 (GRCm39) missense probably benign 0.00
R1704:Camta1 UTSW 4 151,159,681 (GRCm39) missense probably damaging 1.00
R1718:Camta1 UTSW 4 151,168,481 (GRCm39) missense probably benign 0.00
R1941:Camta1 UTSW 4 151,159,612 (GRCm39) missense probably damaging 1.00
R1967:Camta1 UTSW 4 151,173,430 (GRCm39) missense probably damaging 0.99
R1998:Camta1 UTSW 4 151,162,337 (GRCm39) missense probably damaging 1.00
R2081:Camta1 UTSW 4 151,228,699 (GRCm39) missense probably benign 0.24
R2104:Camta1 UTSW 4 151,537,751 (GRCm39) missense probably damaging 0.99
R2240:Camta1 UTSW 4 151,169,032 (GRCm39) missense possibly damaging 0.66
R4516:Camta1 UTSW 4 151,229,177 (GRCm39) missense possibly damaging 0.90
R4539:Camta1 UTSW 4 151,169,269 (GRCm39) missense probably benign 0.03
R4552:Camta1 UTSW 4 151,876,959 (GRCm39) missense probably damaging 0.96
R4658:Camta1 UTSW 4 151,228,367 (GRCm39) missense probably damaging 1.00
R4725:Camta1 UTSW 4 151,232,953 (GRCm39) missense probably benign 0.11
R4786:Camta1 UTSW 4 151,374,496 (GRCm39) missense probably damaging 1.00
R4812:Camta1 UTSW 4 151,215,999 (GRCm39) missense probably null 0.25
R4840:Camta1 UTSW 4 151,228,864 (GRCm39) missense probably benign 0.23
R5038:Camta1 UTSW 4 151,229,926 (GRCm39) missense probably damaging 1.00
R5112:Camta1 UTSW 4 151,158,511 (GRCm39) missense probably damaging 1.00
R5251:Camta1 UTSW 4 151,248,341 (GRCm39) missense probably damaging 1.00
R5388:Camta1 UTSW 4 151,159,695 (GRCm39) missense probably damaging 1.00
R5487:Camta1 UTSW 4 151,229,211 (GRCm39) missense possibly damaging 0.73
R6343:Camta1 UTSW 4 151,164,306 (GRCm39) missense probably damaging 0.98
R6462:Camta1 UTSW 4 151,170,621 (GRCm39) missense probably damaging 0.98
R6550:Camta1 UTSW 4 151,222,832 (GRCm39) missense probably damaging 1.00
R6990:Camta1 UTSW 4 151,229,501 (GRCm39) missense probably damaging 0.97
R7165:Camta1 UTSW 4 151,169,157 (GRCm39) missense possibly damaging 0.63
R7190:Camta1 UTSW 4 151,232,980 (GRCm39) missense possibly damaging 0.57
R7215:Camta1 UTSW 4 151,229,194 (GRCm39) missense probably damaging 1.00
R7264:Camta1 UTSW 4 151,537,856 (GRCm39) missense probably damaging 1.00
R7403:Camta1 UTSW 4 151,537,752 (GRCm39) nonsense probably null
R7445:Camta1 UTSW 4 151,228,748 (GRCm39) missense possibly damaging 0.94
R7447:Camta1 UTSW 4 151,168,327 (GRCm39) missense probably benign 0.31
R7585:Camta1 UTSW 4 151,229,287 (GRCm39) missense probably damaging 1.00
R7751:Camta1 UTSW 4 151,232,863 (GRCm39) splice site probably null
R7881:Camta1 UTSW 4 151,920,333 (GRCm39) missense probably damaging 0.99
R7933:Camta1 UTSW 4 151,168,214 (GRCm39) missense probably damaging 0.99
R7960:Camta1 UTSW 4 151,232,990 (GRCm39) missense probably benign 0.01
R8057:Camta1 UTSW 4 151,228,489 (GRCm39) missense probably damaging 1.00
R8073:Camta1 UTSW 4 151,163,281 (GRCm39) missense probably damaging 1.00
R8241:Camta1 UTSW 4 151,168,282 (GRCm39) missense probably benign 0.00
R8247:Camta1 UTSW 4 151,159,721 (GRCm39) missense probably damaging 1.00
R8466:Camta1 UTSW 4 151,170,577 (GRCm39) nonsense probably null
R9035:Camta1 UTSW 4 151,229,159 (GRCm39) missense probably benign 0.03
R9332:Camta1 UTSW 4 151,228,474 (GRCm39) missense possibly damaging 0.95
R9358:Camta1 UTSW 4 151,222,881 (GRCm39) missense probably damaging 1.00
R9626:Camta1 UTSW 4 151,168,287 (GRCm39) missense probably damaging 0.99
R9649:Camta1 UTSW 4 151,216,004 (GRCm39) missense possibly damaging 0.82
X0063:Camta1 UTSW 4 151,229,704 (GRCm39) missense probably damaging 1.00
Z1176:Camta1 UTSW 4 151,228,842 (GRCm39) missense probably benign 0.06
Z1177:Camta1 UTSW 4 151,162,382 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCAGCTGTCTGTGGTTG -3'
(R):5'- ATGCACACCATTATTTCTCGTTGG -3'

Sequencing Primer
(F):5'- GGCTCTTCGCTTGGGGC -3'
(R):5'- CTCGTTGGAATCAGATAGCTGTAATG -3'
Posted On 2015-09-25