Incidental Mutation 'R4610:Ltbp4'
ID344606
Institutional Source Beutler Lab
Gene Symbol Ltbp4
Ensembl Gene ENSMUSG00000040488
Gene Namelatent transforming growth factor beta binding protein 4
Synonyms2310046A13Rik
MMRRC Submission 041821-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4610 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27305136-27337692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27306700 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1453 (E1453K)
Ref Sequence ENSEMBL: ENSMUSP00000113674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038618] [ENSMUST00000108369] [ENSMUST00000118583] [ENSMUST00000121175] [ENSMUST00000125455]
Predicted Effect probably damaging
Transcript: ENSMUST00000038618
AA Change: E1519K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037536
Gene: ENSMUSG00000040488
AA Change: E1519K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
EGF 151 180 2.74e-3 SMART
low complexity region 244 265 N/A INTRINSIC
EGF_CA 356 396 3.51e-10 SMART
Pfam:TB 416 457 4.8e-15 PFAM
low complexity region 490 501 N/A INTRINSIC
low complexity region 507 568 N/A INTRINSIC
low complexity region 579 590 N/A INTRINSIC
EGF 591 629 6.06e-5 SMART
EGF_CA 630 671 8.3e-12 SMART
EGF_CA 672 713 7.34e-13 SMART
EGF_CA 714 751 8.43e-13 SMART
EGF_CA 753 794 1.66e-11 SMART
EGF_CA 795 836 3.61e-12 SMART
EGF_CA 837 876 5.61e-9 SMART
EGF_CA 877 919 1.73e-9 SMART
EGF_CA 920 961 7.12e-11 SMART
EGF_CA 962 1002 3.56e-11 SMART
EGF_CA 1003 1046 1.61e-9 SMART
EGF_CA 1047 1090 2.13e-9 SMART
EGF_CA 1091 1132 1.02e-11 SMART
EGF 1136 1175 1.69e1 SMART
low complexity region 1185 1223 N/A INTRINSIC
Pfam:TB 1234 1276 1.7e-13 PFAM
EGF_CA 1295 1337 2.72e-7 SMART
EGF_CA 1338 1379 1.36e-7 SMART
Pfam:TB 1402 1443 4.3e-14 PFAM
low complexity region 1449 1461 N/A INTRINSIC
low complexity region 1478 1500 N/A INTRINSIC
EGF 1578 1615 6.06e-5 SMART
EGF_CA 1616 1660 9.54e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108369
AA Change: E1518K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104006
Gene: ENSMUSG00000040488
AA Change: E1518K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 116 145 N/A INTRINSIC
EGF 150 179 2.74e-3 SMART
low complexity region 243 264 N/A INTRINSIC
EGF_CA 355 395 3.51e-10 SMART
Pfam:TB 414 456 2.5e-14 PFAM
low complexity region 489 500 N/A INTRINSIC
low complexity region 506 567 N/A INTRINSIC
low complexity region 578 589 N/A INTRINSIC
EGF 590 628 6.06e-5 SMART
EGF_CA 629 670 8.3e-12 SMART
EGF_CA 671 712 7.34e-13 SMART
EGF_CA 713 750 8.43e-13 SMART
EGF_CA 752 793 1.66e-11 SMART
EGF_CA 794 835 3.61e-12 SMART
EGF_CA 836 875 5.61e-9 SMART
EGF_CA 876 918 1.73e-9 SMART
EGF_CA 919 960 7.12e-11 SMART
EGF_CA 961 1001 3.56e-11 SMART
EGF_CA 1002 1045 1.61e-9 SMART
EGF_CA 1046 1089 2.13e-9 SMART
EGF_CA 1090 1131 1.02e-11 SMART
EGF 1135 1174 1.69e1 SMART
low complexity region 1184 1222 N/A INTRINSIC
Pfam:TB 1232 1275 2.4e-13 PFAM
EGF_CA 1294 1336 2.72e-7 SMART
EGF_CA 1337 1378 1.36e-7 SMART
Pfam:TB 1400 1442 7.6e-15 PFAM
low complexity region 1448 1460 N/A INTRINSIC
low complexity region 1477 1499 N/A INTRINSIC
EGF 1577 1614 6.06e-5 SMART
EGF_CA 1615 1659 9.54e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118583
AA Change: E1453K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113523
Gene: ENSMUSG00000040488
AA Change: E1453K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 2.3e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 2.2e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 7.1e-15 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121175
AA Change: E1453K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113674
Gene: ENSMUSG00000040488
AA Change: E1453K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 3.4e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 3.3e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 1e-14 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
EGF_CA 1550 1594 9.54e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125455
AA Change: E203K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120326
Gene: ENSMUSG00000040488
AA Change: E203K

DomainStartEndE-ValueType
Pfam:TB 9 52 1.9e-14 PFAM
Pfam:TB 85 127 6e-16 PFAM
low complexity region 133 145 N/A INTRINSIC
low complexity region 162 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206413
Meta Mutation Damage Score 0.1659 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds transforming growth factor beta (TGFB) as it is secreted and targeted to the extracellular matrix. TGFB is biologically latent after secretion and insertion into the extracellular matrix, and sheds TGFB and other proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous disruption of this locus results in pulmonary emphysema, cardiomyopathy, and colon cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Adgre1 C A 17: 57,450,073 Q777K possibly damaging Het
Agpat4 G A 17: 12,210,377 probably null Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankle1 AT A 8: 71,407,207 probably benign Het
Ankrd44 T G 1: 54,766,748 probably benign Het
Aprt A T 8: 122,575,415 probably null Het
Aptx T C 4: 40,702,766 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Cacng7 T A 7: 3,336,691 M36K probably benign Het
Camta1 A G 4: 151,084,827 W156R probably damaging Het
Casd1 G A 6: 4,631,165 probably null Het
Casz1 T A 4: 148,933,267 Y338N probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cit A G 5: 115,994,087 T1801A probably benign Het
Cnot2 A G 10: 116,499,418 I275T probably damaging Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dst T C 1: 34,169,856 L820P probably damaging Het
Dusp11 T A 6: 85,950,055 N193Y probably damaging Het
Eif3m A T 2: 105,013,288 N116K probably benign Het
Epb41l1 A T 2: 156,509,261 E418D possibly damaging Het
Esyt2 T G 12: 116,318,890 N153K probably damaging Het
Exoc6b T G 6: 85,003,159 probably benign Het
Ezr C T 17: 6,739,722 E502K possibly damaging Het
Fbxw11 T A 11: 32,711,859 Y66N possibly damaging Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Fry T C 5: 150,386,104 L671P probably damaging Het
Galnt7 A G 8: 57,545,769 I262T probably damaging Het
Glp1r T C 17: 30,931,247 F381S probably benign Het
Gm3867 T C 9: 36,257,271 noncoding transcript Het
Gm5662 T C 12: 88,271,774 N72S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gstm7 G A 3: 107,926,919 T206I possibly damaging Het
Hist1h2bf A T 13: 23,574,057 V45E possibly damaging Het
Hs3st5 A T 10: 36,828,806 D35V probably benign Het
Hspa13 T C 16: 75,761,302 H125R probably benign Het
Hspa1a T G 17: 34,971,180 H249P probably damaging Het
Igkv10-95 A T 6: 68,680,578 Q6L probably damaging Het
Il1rap T A 16: 26,714,776 L474H probably benign Het
Ipo11 T A 13: 106,879,737 Y489F probably benign Het
Itga5 A G 15: 103,350,832 Y723H probably damaging Het
Itih2 T C 2: 10,105,160 N594S probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Kif26b A G 1: 178,679,355 Y332C probably damaging Het
Kmt2c G A 5: 25,354,384 R1086W probably damaging Het
Ktn1 T A 14: 47,726,179 probably benign Het
Lars2 T A 9: 123,418,693 I305N probably damaging Het
Lgmn G T 12: 102,400,124 probably benign Het
Lypd8 G A 11: 58,386,849 M152I probably benign Het
Man2a1 T A 17: 64,712,459 S773T probably benign Het
Map2k6 T G 11: 110,499,474 L278R probably damaging Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mms19 A G 19: 41,945,496 V811A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtcl1 T A 17: 66,377,887 H520L probably benign Het
Mymk A T 2: 27,062,707 F130I probably damaging Het
Myo1f C T 17: 33,582,332 R333C probably damaging Het
Myo9a T A 9: 59,871,882 H1640Q probably benign Het
Nav1 A G 1: 135,592,448 probably benign Het
Ncbp3 G T 11: 73,079,018 G564C probably damaging Het
Ncoa4 A T 14: 32,176,725 I501L probably benign Het
Ngp T A 9: 110,420,815 N60K possibly damaging Het
Npc1l1 G T 11: 6,228,215 D398E probably damaging Het
Nphs2 T A 1: 156,326,131 M264K probably damaging Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr58 T A 9: 19,783,146 Y4* probably null Het
Patz1 A G 11: 3,306,241 Y509C probably damaging Het
Pax8 G A 2: 24,421,583 P447S probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Pex11g C T 8: 3,465,899 V45M probably benign Het
Pik3ip1 T A 11: 3,333,327 S142R probably damaging Het
Pitpnm2 C G 5: 124,125,371 A819P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plin4 T A 17: 56,105,418 M538L probably benign Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rev1 T C 1: 38,053,649 E1202G probably damaging Het
Rngtt T A 4: 33,339,133 probably benign Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgsm1 A T 5: 113,255,307 F958Y probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorl1 C T 9: 42,031,914 V889M possibly damaging Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stam A T 2: 14,115,858 H53L probably damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tarbp1 A G 8: 126,474,330 Y246H probably damaging Het
Tbx15 A G 3: 99,352,367 Y518C probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tescl T C 7: 24,333,258 E214G probably damaging Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tmem132d A G 5: 127,984,296 V414A probably benign Het
Tmem41b T A 7: 109,974,734 probably benign Het
Tnfrsf18 A G 4: 156,021,880 probably benign Het
Tulp4 T A 17: 6,198,833 D42E probably damaging Het
Ubtd1 A G 19: 42,033,664 N125S probably damaging Het
Ubxn4 T A 1: 128,255,449 F68I probably benign Het
Urb1 A G 16: 90,776,271 S958P probably benign Het
Vash2 T C 1: 190,960,301 S226G probably benign Het
Vmn2r120 C T 17: 57,509,120 G745E probably damaging Het
Vmn2r58 T A 7: 41,837,693 I593F probably benign Het
Zfp398 T C 6: 47,840,427 L67P probably damaging Het
Zfp607b T A 7: 27,703,695 H525Q probably damaging Het
Zfp629 T C 7: 127,612,320 T106A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zic5 T A 14: 122,464,800 D173V probably damaging Het
Zranb2 G A 3: 157,541,884 probably benign Het
Other mutations in Ltbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ltbp4 APN 7 27328805 missense probably damaging 0.96
IGL00585:Ltbp4 APN 7 27326733 missense probably damaging 0.98
IGL01320:Ltbp4 APN 7 27328359 splice site probably benign
IGL01860:Ltbp4 APN 7 27319646 missense probably damaging 1.00
IGL02026:Ltbp4 APN 7 27327417 nonsense probably null
IGL02226:Ltbp4 APN 7 27306934 missense probably damaging 1.00
IGL02422:Ltbp4 APN 7 27319672 missense probably damaging 1.00
IGL02611:Ltbp4 APN 7 27310655 missense probably damaging 1.00
IGL02892:Ltbp4 APN 7 27310649 missense probably damaging 1.00
IGL02926:Ltbp4 APN 7 27328872 splice site probably null
IGL02950:Ltbp4 APN 7 27306718 missense probably damaging 0.99
IGL03008:Ltbp4 APN 7 27324364 missense probably damaging 0.99
IGL03271:Ltbp4 APN 7 27329815 missense unknown
IGL02837:Ltbp4 UTSW 7 27314381 missense probably damaging 1.00
R0792:Ltbp4 UTSW 7 27325060 missense probably damaging 1.00
R0980:Ltbp4 UTSW 7 27324162 missense probably damaging 1.00
R1017:Ltbp4 UTSW 7 27306076 missense possibly damaging 0.95
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27310535 missense probably damaging 1.00
R1403:Ltbp4 UTSW 7 27329039 missense unknown
R1403:Ltbp4 UTSW 7 27329039 missense unknown
R1448:Ltbp4 UTSW 7 27306577 missense possibly damaging 0.86
R1575:Ltbp4 UTSW 7 27322820 missense probably damaging 1.00
R1918:Ltbp4 UTSW 7 27337569 unclassified probably benign
R1932:Ltbp4 UTSW 7 27307766 critical splice donor site probably null
R1959:Ltbp4 UTSW 7 27329018 missense unknown
R1960:Ltbp4 UTSW 7 27329018 missense unknown
R1976:Ltbp4 UTSW 7 27326770 missense probably damaging 1.00
R2060:Ltbp4 UTSW 7 27308953 missense probably damaging 1.00
R2333:Ltbp4 UTSW 7 27327778 missense possibly damaging 0.82
R2431:Ltbp4 UTSW 7 27319676 missense possibly damaging 0.91
R3125:Ltbp4 UTSW 7 27327778 missense possibly damaging 0.82
R4093:Ltbp4 UTSW 7 27325216 missense possibly damaging 0.93
R4095:Ltbp4 UTSW 7 27325216 missense possibly damaging 0.93
R4592:Ltbp4 UTSW 7 27325183 missense probably damaging 0.96
R4650:Ltbp4 UTSW 7 27314309 missense probably damaging 1.00
R4912:Ltbp4 UTSW 7 27306116 nonsense probably null
R5002:Ltbp4 UTSW 7 27327685 frame shift probably null
R5016:Ltbp4 UTSW 7 27327685 frame shift probably null
R5216:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5218:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5219:Ltbp4 UTSW 7 27327311 small deletion probably benign
R5219:Ltbp4 UTSW 7 27327321 missense probably benign 0.01
R5539:Ltbp4 UTSW 7 27327724 missense probably damaging 0.97
R5991:Ltbp4 UTSW 7 27309316 missense probably damaging 1.00
R6082:Ltbp4 UTSW 7 27335680 unclassified probably benign
R6125:Ltbp4 UTSW 7 27327755 missense probably damaging 1.00
R6146:Ltbp4 UTSW 7 27319724 missense probably damaging 0.99
R6156:Ltbp4 UTSW 7 27330162 missense unknown
R6414:Ltbp4 UTSW 7 27310715 missense probably damaging 1.00
R6563:Ltbp4 UTSW 7 27309063 missense probably damaging 1.00
R6719:Ltbp4 UTSW 7 27328763 missense probably damaging 0.99
R6940:Ltbp4 UTSW 7 27308944 missense probably damaging 1.00
R7054:Ltbp4 UTSW 7 27307766 critical splice donor site probably null
R7116:Ltbp4 UTSW 7 27305427 missense probably damaging 0.99
R7326:Ltbp4 UTSW 7 27329755 missense unknown
R7419:Ltbp4 UTSW 7 27329767 missense unknown
X0025:Ltbp4 UTSW 7 27325802 missense probably damaging 1.00
X0066:Ltbp4 UTSW 7 27306065 critical splice donor site probably null
Z1088:Ltbp4 UTSW 7 27307792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCTCCCATCTTGTGTG -3'
(R):5'- CTGGTGGCTTTGGAATTCCC -3'

Sequencing Primer
(F):5'- CATCTCCCATCTTGTGTGTGTGTG -3'
(R):5'- GGAATTCCCTATGAATATGGCCCAG -3'
Posted On2015-09-25