Mutagenetix > Incidental Mutation

Incidental Mutation 'R4610:Myo9a'

344624

Institutional Source

Beutler Lab

Gene Symbol

Myo9a

Ensembl Gene

ENSMUSG00000039585

Gene Name

myosin IXa

Synonyms

C130068I12Rik, 4732465J09Rik

MMRRC Submission

041821-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4610 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59750896-59928866 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59871882 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1640 (H1640Q)

Ref Sequence

ENSEMBL: ENSMUSP00000122852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]

AlphaFold

Q8C170

Predicted Effect

probably benign
Transcript: ENSMUST00000128341
AA Change: H1640Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: H1640Q

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
Blast:MYSc	1685	1938	6e-89	BLAST
low complexity region	1982	1993	N/A	INTRINSIC
C1	2002	2050	2.6e-9	SMART
RhoGAP	2075	2250	3.36e-73	SMART
coiled coil region	2320	2360	N/A	INTRINSIC
low complexity region	2419	2438	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135298
AA Change: H1640Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: H1640Q

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2391	2431	N/A	INTRINSIC
low complexity region	2490	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136740
AA Change: H1640Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: H1640Q

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2409	2449	N/A	INTRINSIC
low complexity region	2508	2527	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147364

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215963

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (121/124)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,970,468	I69N	probably damaging	Het
Aars2	T	A	17: 45,516,921	D555E	probably damaging	Het
Adgre1	C	A	17: 57,450,073	Q777K	possibly damaging	Het
Agpat4	G	A	17: 12,210,377		probably null	Het
Ak7	G	A	12: 105,713,575	V123M	probably benign	Het
Ankle1	AT	A	8: 71,407,207		probably benign	Het
Ankrd44	T	G	1: 54,766,748		probably benign	Het
Aprt	A	T	8: 122,575,415		probably null	Het
Aptx	T	C	4: 40,702,766		probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
AY358078	T	A	14: 51,826,075	C393S	possibly damaging	Het
Bbip1	T	C	19: 53,932,175	M1V	probably null	Het
Cacng7	T	A	7: 3,336,691	M36K	probably benign	Het
Camta1	A	G	4: 151,084,827	W156R	probably damaging	Het
Casd1	G	A	6: 4,631,165		probably null	Het
Casz1	T	A	4: 148,933,267	Y338N	probably damaging	Het
Ccdc66	T	C	14: 27,500,420	N122S	probably damaging	Het
Celf2	G	T	2: 6,586,020	N279K	possibly damaging	Het
Cit	A	G	5: 115,994,087	T1801A	probably benign	Het
Cnot2	A	G	10: 116,499,418	I275T	probably damaging	Het
Ddx4	T	C	13: 112,612,060	K435E	probably damaging	Het
Dnajc6	T	C	4: 101,611,264	F166L	probably damaging	Het
Dst	T	C	1: 34,169,856	L820P	probably damaging	Het
Dusp11	T	A	6: 85,950,055	N193Y	probably damaging	Het
Eif3m	A	T	2: 105,013,288	N116K	probably benign	Het
Epb41l1	A	T	2: 156,509,261	E418D	possibly damaging	Het
Esyt2	T	G	12: 116,318,890	N153K	probably damaging	Het
Exoc6b	T	G	6: 85,003,159		probably benign	Het
Ezr	C	T	17: 6,739,722	E502K	possibly damaging	Het
Fbxw11	T	A	11: 32,711,859	Y66N	possibly damaging	Het
Frem2	A	G	3: 53,547,807	L2116S	possibly damaging	Het
Fry	T	C	5: 150,386,104	L671P	probably damaging	Het
Galnt7	A	G	8: 57,545,769	I262T	probably damaging	Het
Glp1r	T	C	17: 30,931,247	F381S	probably benign	Het
Gm3867	T	C	9: 36,257,271		noncoding transcript	Het
Gm5662	T	C	12: 88,271,774	N72S	probably benign	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Golgb1	A	G	16: 36,918,625	D2442G	probably damaging	Het
Gp1bb	A	T	16: 18,621,143	L67Q	probably damaging	Het
Gstm7	G	A	3: 107,926,919	T206I	possibly damaging	Het
Hist1h2bf	A	T	13: 23,574,057	V45E	possibly damaging	Het
Hs3st5	A	T	10: 36,828,806	D35V	probably benign	Het
Hspa13	T	C	16: 75,761,302	H125R	probably benign	Het
Hspa1a	T	G	17: 34,971,180	H249P	probably damaging	Het
Igkv10-95	A	T	6: 68,680,578	Q6L	probably damaging	Het
Il1rap	T	A	16: 26,714,776	L474H	probably benign	Het
Ipo11	T	A	13: 106,879,737	Y489F	probably benign	Het
Itga5	A	G	15: 103,350,832	Y723H	probably damaging	Het
Itih2	T	C	2: 10,105,160	N594S	probably damaging	Het
Itk	T	A	11: 46,336,515	Q427L	probably benign	Het
Kif26b	A	G	1: 178,679,355	Y332C	probably damaging	Het
Kmt2c	G	A	5: 25,354,384	R1086W	probably damaging	Het
Ktn1	T	A	14: 47,726,179		probably benign	Het
Lars2	T	A	9: 123,418,693	I305N	probably damaging	Het
Lgmn	G	T	12: 102,400,124		probably benign	Het
Ltbp4	C	T	7: 27,306,700	E1453K	probably damaging	Het
Lypd8	G	A	11: 58,386,849	M152I	probably benign	Het
Man2a1	T	A	17: 64,712,459	S773T	probably benign	Het
Map2k6	T	G	11: 110,499,474	L278R	probably damaging	Het
Mbtps1	A	T	8: 119,535,347	D354E	probably damaging	Het
Mcpt9	C	T	14: 56,028,592	V60M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Mms19	A	G	19: 41,945,496	V811A	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mtcl1	T	A	17: 66,377,887	H520L	probably benign	Het
Mymk	A	T	2: 27,062,707	F130I	probably damaging	Het
Myo1f	C	T	17: 33,582,332	R333C	probably damaging	Het
Nav1	A	G	1: 135,592,448		probably benign	Het
Ncbp3	G	T	11: 73,079,018	G564C	probably damaging	Het
Ncoa4	A	T	14: 32,176,725	I501L	probably benign	Het
Ngp	T	A	9: 110,420,815	N60K	possibly damaging	Het
Npc1l1	G	T	11: 6,228,215	D398E	probably damaging	Het
Nphs2	T	A	1: 156,326,131	M264K	probably damaging	Het
Olfr1193	G	A	2: 88,677,896	V14I	probably benign	Het
Olfr1193	T	G	2: 88,678,179	V101G	probably benign	Het
Olfr145	T	A	9: 37,898,326	S307R	probably benign	Het
Olfr58	T	A	9: 19,783,146	Y4*	probably null	Het
Patz1	A	G	11: 3,306,241	Y509C	probably damaging	Het
Pax8	G	A	2: 24,421,583	P447S	probably damaging	Het
Pde11a	A	G	2: 76,158,333	V488A	probably benign	Het
Pex11g	C	T	8: 3,465,899	V45M	probably benign	Het
Pik3ip1	T	A	11: 3,333,327	S142R	probably damaging	Het
Pitpnm2	C	G	5: 124,125,371	A819P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plin4	T	A	17: 56,105,418	M538L	probably benign	Het
Ppp3cb	T	C	14: 20,520,646	N339S	possibly damaging	Het
Rev1	T	C	1: 38,053,649	E1202G	probably damaging	Het
Rngtt	T	A	4: 33,339,133		probably benign	Het
Serpinb12	T	A	1: 106,949,153	D66E	probably benign	Het
Sgsm1	A	T	5: 113,255,307	F958Y	probably damaging	Het
Slc35e2	T	C	4: 155,617,649	F290S	probably benign	Het
Sorl1	C	T	9: 42,031,914	V889M	possibly damaging	Het
Sptlc3	G	A	2: 139,636,680	V520I	probably benign	Het
Stam	A	T	2: 14,115,858	H53L	probably damaging	Het
Stox2	A	G	8: 47,192,935	S497P	probably damaging	Het
Tarbp1	A	G	8: 126,474,330	Y246H	probably damaging	Het
Tbx15	A	G	3: 99,352,367	Y518C	probably damaging	Het
Tdrd5	T	A	1: 156,284,374	T479S	probably benign	Het
Tescl	T	C	7: 24,333,258	E214G	probably damaging	Het
Tex10	T	C	4: 48,452,946	D671G	probably benign	Het
Tmem132d	A	G	5: 127,984,296	V414A	probably benign	Het
Tmem41b	T	A	7: 109,974,734		probably benign	Het
Tnfrsf18	A	G	4: 156,021,880		probably benign	Het
Tulp4	T	A	17: 6,198,833	D42E	probably damaging	Het
Ubtd1	A	G	19: 42,033,664	N125S	probably damaging	Het
Ubxn4	T	A	1: 128,255,449	F68I	probably benign	Het
Urb1	A	G	16: 90,776,271	S958P	probably benign	Het
Vash2	T	C	1: 190,960,301	S226G	probably benign	Het
Vmn2r120	C	T	17: 57,509,120	G745E	probably damaging	Het
Vmn2r58	T	A	7: 41,837,693	I593F	probably benign	Het
Zfp398	T	C	6: 47,840,427	L67P	probably damaging	Het
Zfp607b	T	A	7: 27,703,695	H525Q	probably damaging	Het
Zfp629	T	C	7: 127,612,320	T106A	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zic5	T	A	14: 122,464,800	D173V	probably damaging	Het
Zranb2	G	A	3: 157,541,884		probably benign	Het

Other mutations in Myo9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Myo9a	APN	9	59843059	splice site	probably benign
IGL00510:Myo9a	APN	9	59832181	splice site	probably benign
IGL00710:Myo9a	APN	9	59875311	missense	probably damaging	1.00
IGL00963:Myo9a	APN	9	59900372	missense	probably damaging	0.98
IGL01087:Myo9a	APN	9	59790078	missense	possibly damaging	0.93
IGL01145:Myo9a	APN	9	59855375	missense	probably benign	0.18
IGL01403:Myo9a	APN	9	59871563	missense	probably damaging	0.98
IGL01528:Myo9a	APN	9	59779674	missense	probably damaging	1.00
IGL01608:Myo9a	APN	9	59870836	nonsense	probably null
IGL01701:Myo9a	APN	9	59884594	critical splice donor site	probably null
IGL01918:Myo9a	APN	9	59779702	missense	probably damaging	1.00
IGL02026:Myo9a	APN	9	59905962	missense	probably damaging	0.99
IGL02139:Myo9a	APN	9	59779992	missense	probably benign	0.07
IGL02176:Myo9a	APN	9	59870553	missense	probably benign	0.45
IGL02272:Myo9a	APN	9	59884600	splice site	probably benign
IGL02283:Myo9a	APN	9	59871673	missense	probably benign	0.00
IGL02499:Myo9a	APN	9	59815386	splice site	probably benign
IGL02652:Myo9a	APN	9	59863928	missense	probably damaging	1.00
IGL02666:Myo9a	APN	9	59924904	missense	probably benign	0.02
IGL02878:Myo9a	APN	9	59908300	critical splice donor site	probably null
IGL02982:Myo9a	APN	9	59908208	nonsense	probably null
IGL03072:Myo9a	APN	9	59809442	missense	possibly damaging	0.83
IGL03090:Myo9a	APN	9	59894135	splice site	probably benign
IGL03111:Myo9a	APN	9	59827243	missense	probably benign	0.19
IGL03389:Myo9a	APN	9	59869607	missense	probably damaging	1.00
essentials	UTSW	9	59894866	missense	probably benign	0.09
necessities	UTSW	9	59815334	missense	probably damaging	1.00
PIT4402001:Myo9a	UTSW	9	59870436	missense	possibly damaging	0.83
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0329:Myo9a	UTSW	9	59923677	missense	probably damaging	1.00
R0423:Myo9a	UTSW	9	59895336	missense	probably damaging	1.00
R0521:Myo9a	UTSW	9	59894352	missense	probably damaging	1.00
R0607:Myo9a	UTSW	9	59921793	missense	probably benign	0.02
R0652:Myo9a	UTSW	9	59871926	missense	probably benign
R0653:Myo9a	UTSW	9	59924991	missense	probably damaging	1.00
R0723:Myo9a	UTSW	9	59871100	missense	probably benign	0.01
R0784:Myo9a	UTSW	9	59896545	splice site	probably benign
R0842:Myo9a	UTSW	9	59871067	missense	probably benign	0.02
R1055:Myo9a	UTSW	9	59855370	missense	probably benign	0.01
R1056:Myo9a	UTSW	9	59832201	missense	possibly damaging	0.64
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1615:Myo9a	UTSW	9	59788456	missense	possibly damaging	0.68
R1698:Myo9a	UTSW	9	59868181	missense	probably benign	0.05
R1715:Myo9a	UTSW	9	59832300	missense	probably damaging	0.99
R1981:Myo9a	UTSW	9	59894146	missense	probably benign
R2228:Myo9a	UTSW	9	59894180	missense	probably benign	0.06
R2272:Myo9a	UTSW	9	59815301	missense	probably damaging	1.00
R2327:Myo9a	UTSW	9	59779765	missense	probably benign	0.11
R2990:Myo9a	UTSW	9	59924889	missense	possibly damaging	0.95
R3161:Myo9a	UTSW	9	59832315	splice site	probably benign
R3721:Myo9a	UTSW	9	59868180	missense	probably benign
R3928:Myo9a	UTSW	9	59895283	missense	probably damaging	1.00
R4197:Myo9a	UTSW	9	59894866	missense	probably benign	0.09
R4212:Myo9a	UTSW	9	59906066	nonsense	probably null
R4616:Myo9a	UTSW	9	59821649	missense	probably damaging	1.00
R4621:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4623:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4632:Myo9a	UTSW	9	59869664	missense	probably benign	0.00
R4657:Myo9a	UTSW	9	59875416	critical splice donor site	probably null
R4892:Myo9a	UTSW	9	59824242	missense	probably damaging	0.98
R4897:Myo9a	UTSW	9	59896517	missense	probably benign	0.07
R4966:Myo9a	UTSW	9	59871734	missense	probably benign	0.00
R4993:Myo9a	UTSW	9	59861472	nonsense	probably null
R5160:Myo9a	UTSW	9	59871802	missense	probably benign	0.24
R5233:Myo9a	UTSW	9	59910617	missense	probably damaging	1.00
R5271:Myo9a	UTSW	9	59907382	missense	probably damaging	1.00
R5308:Myo9a	UTSW	9	59863961	missense	probably damaging	1.00
R5367:Myo9a	UTSW	9	59900449	missense	probably damaging	0.96
R5432:Myo9a	UTSW	9	59865670	missense	possibly damaging	0.94
R5459:Myo9a	UTSW	9	59884520	missense	probably damaging	0.98
R5511:Myo9a	UTSW	9	59780212	missense	probably damaging	1.00
R5568:Myo9a	UTSW	9	59874628	missense	probably benign
R5573:Myo9a	UTSW	9	59871001	missense	probably benign
R5589:Myo9a	UTSW	9	59895244	nonsense	probably null
R5607:Myo9a	UTSW	9	59863944	missense	probably damaging	1.00
R5633:Myo9a	UTSW	9	59868184	missense	possibly damaging	0.60
R5885:Myo9a	UTSW	9	59871220	missense	probably benign
R6024:Myo9a	UTSW	9	59855388	missense	possibly damaging	0.68
R6086:Myo9a	UTSW	9	59790057	nonsense	probably null
R6146:Myo9a	UTSW	9	59871229	missense	probably benign	0.01
R6194:Myo9a	UTSW	9	59869750	missense	probably benign	0.00
R6213:Myo9a	UTSW	9	59827258	missense	probably damaging	1.00
R6368:Myo9a	UTSW	9	59924948	missense	probably benign	0.01
R6550:Myo9a	UTSW	9	59868199	missense	probably damaging	1.00
R6612:Myo9a	UTSW	9	59827196	missense	probably damaging	1.00
R6665:Myo9a	UTSW	9	59871872	missense	probably benign	0.09
R6951:Myo9a	UTSW	9	59894768	missense	probably damaging	1.00
R7026:Myo9a	UTSW	9	59815334	missense	probably damaging	1.00
R7107:Myo9a	UTSW	9	59870815	missense	probably benign	0.44
R7310:Myo9a	UTSW	9	59871153	missense	probably benign	0.08
R7473:Myo9a	UTSW	9	59895244	missense	probably benign	0.31
R7723:Myo9a	UTSW	9	59779858	missense	probably damaging	1.00
R7823:Myo9a	UTSW	9	59811950	missense	probably damaging	1.00
R7824:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R7965:Myo9a	UTSW	9	59788438	missense	probably damaging	1.00
R8031:Myo9a	UTSW	9	59780091	missense	probably benign	0.33
R8055:Myo9a	UTSW	9	59907460	missense	probably damaging	1.00
R8071:Myo9a	UTSW	9	59874648	missense	probably benign
R8250:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R8260:Myo9a	UTSW	9	59910678	missense	probably benign	0.08
R8355:Myo9a	UTSW	9	59909847	missense	probably damaging	1.00
R8432:Myo9a	UTSW	9	59780265	missense	probably damaging	1.00
R8470:Myo9a	UTSW	9	59832290	missense	probably damaging	1.00
R8528:Myo9a	UTSW	9	59860140	missense	probably damaging	1.00
R8681:Myo9a	UTSW	9	59868111	missense	probably benign	0.16
R8690:Myo9a	UTSW	9	59875374	missense	probably benign
R8793:Myo9a	UTSW	9	59884567	missense	probably benign	0.03
R8812:Myo9a	UTSW	9	59779747	missense	probably benign	0.14
R9016:Myo9a	UTSW	9	59868144	nonsense	probably null
R9026:Myo9a	UTSW	9	59809474	missense	probably damaging	0.96
R9036:Myo9a	UTSW	9	59780301	nonsense	probably null
R9130:Myo9a	UTSW	9	59832231	missense	probably damaging	0.98
R9131:Myo9a	UTSW	9	59861489	missense	probably damaging	1.00
R9213:Myo9a	UTSW	9	59865639	missense	probably benign	0.04
R9498:Myo9a	UTSW	9	59827183	missense	probably damaging	1.00
R9575:Myo9a	UTSW	9	59905907	missense	probably damaging	1.00
R9651:Myo9a	UTSW	9	59871481	missense	probably damaging	0.96
R9672:Myo9a	UTSW	9	59780049	missense	probably benign	0.16
RF018:Myo9a	UTSW	9	59869586	missense	probably benign	0.00
RF019:Myo9a	UTSW	9	59921772	missense	probably benign	0.00
Z1176:Myo9a	UTSW	9	59895259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGTTCCCCATCAGCAGTC -3'
(R):5'- CAGCATTCATGTACACAGAGC -3'

Sequencing Primer
(F):5'- GTCACTAAAAGAGACGCAGCTCTTG -3'
(R):5'- TATGTGAGAAATTCCCCCACTTAAC -3'

Posted On

2015-09-25