Incidental Mutation 'R4610:Patz1'
ID 344629
Institutional Source Beutler Lab
Gene Symbol Patz1
Ensembl Gene ENSMUSG00000020453
Gene Name POZ (BTB) and AT hook containing zinc finger 1
Synonyms MAZR, 8430401L15Rik, POZ-AT hook-zinc finger protein, Zfp278
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.934) question?
Stock # R4610 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 3239131-3259083 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3256241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 509 (Y509C)
Ref Sequence ENSEMBL: ENSMUSP00000105670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057089] [ENSMUST00000093402] [ENSMUST00000110043] [ENSMUST00000134089] [ENSMUST00000154319]
AlphaFold Q5NBY9
Predicted Effect probably benign
Transcript: ENSMUST00000057089
SMART Domains Protein: ENSMUSP00000050684
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 559 582 1.98e-4 SMART
low complexity region 585 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093402
SMART Domains Protein: ENSMUSP00000091103
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101644
Predicted Effect probably damaging
Transcript: ENSMUST00000110043
AA Change: Y509C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105670
Gene: ENSMUSG00000020453
AA Change: Y509C

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 495 517 1.26e-2 SMART
Pfam:zf-C2H2_assoc3 536 604 6.5e-36 PFAM
ZnF_C2H2 605 628 1.98e-4 SMART
low complexity region 631 644 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123983
Predicted Effect probably benign
Transcript: ENSMUST00000134089
SMART Domains Protein: ENSMUSP00000138522
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 5 29 2.82e0 SMART
ZnF_C2H2 33 54 2.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152576
Predicted Effect probably benign
Transcript: ENSMUST00000154319
SMART Domains Protein: ENSMUSP00000122832
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 6 25 5.68e1 SMART
ZnF_C2H2 29 50 2.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155332
Meta Mutation Damage Score 0.3989 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an A-T hook DNA binding motif which usually binds to other DNA binding structures to play an important role in chromatin modeling and transcription regulation. Its Poz domain is thought to function as a site for protein-protein interaction and is required for transcriptional repression, and the zinc-fingers comprise the DNA binding domain. Since the encoded protein has typical features of a transcription factor, it is postulated to be a repressor of gene expression. In small round cell sarcoma, this gene is fused to EWS by a small inversion of 22q, then the hybrid is thought to be translocated (t(1;22)(p36.1;q12). The rearrangement of chromosome 22 involves intron 8 of EWS and exon 1 of this gene creating a chimeric sequence containing the transactivation domain of EWS fused to zinc finger domain of this protein. This is a distinct example of an intra-chromosomal rearrangement of chromosome 22. Four alternatively spliced transcript variants are described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic and fetal lethality, exencephaly, nervous system defects, outflow defects, transposition of great arteries, postnatal growth retardation and male and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Adgre1 C A 17: 57,757,073 (GRCm39) Q777K possibly damaging Het
Agpat4 G A 17: 12,429,264 (GRCm39) probably null Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Ankle1 AT A 8: 71,859,851 (GRCm39) probably benign Het
Ankrd44 T G 1: 54,805,907 (GRCm39) probably benign Het
Aprt A T 8: 123,302,154 (GRCm39) probably null Het
Aptx T C 4: 40,702,766 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Cacng7 T A 7: 3,385,207 (GRCm39) M36K probably benign Het
Camta1 A G 4: 151,169,284 (GRCm39) W156R probably damaging Het
Casd1 G A 6: 4,631,165 (GRCm39) probably null Het
Casz1 T A 4: 149,017,724 (GRCm39) Y338N probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cit A G 5: 116,132,146 (GRCm39) T1801A probably benign Het
Cnot2 A G 10: 116,335,323 (GRCm39) I275T probably damaging Het
Ddx4 T C 13: 112,748,594 (GRCm39) K435E probably damaging Het
Dnajc6 T C 4: 101,468,461 (GRCm39) F166L probably damaging Het
Dst T C 1: 34,208,937 (GRCm39) L820P probably damaging Het
Dusp11 T A 6: 85,927,037 (GRCm39) N193Y probably damaging Het
Eif1ad7 T C 12: 88,238,544 (GRCm39) N72S probably benign Het
Eif3m A T 2: 104,843,633 (GRCm39) N116K probably benign Het
Epb41l1 A T 2: 156,351,181 (GRCm39) E418D possibly damaging Het
Esyt2 T G 12: 116,282,510 (GRCm39) N153K probably damaging Het
Exoc6b T G 6: 84,980,141 (GRCm39) probably benign Het
Ezr C T 17: 7,007,121 (GRCm39) E502K possibly damaging Het
Fbxw11 T A 11: 32,661,859 (GRCm39) Y66N possibly damaging Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Fry T C 5: 150,309,569 (GRCm39) L671P probably damaging Het
Galnt7 A G 8: 57,998,803 (GRCm39) I262T probably damaging Het
Glp1r T C 17: 31,150,221 (GRCm39) F381S probably benign Het
Gm3867 T C 9: 36,168,567 (GRCm39) noncoding transcript Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Gp1bb A T 16: 18,439,893 (GRCm39) L67Q probably damaging Het
Gstm7 G A 3: 107,834,235 (GRCm39) T206I possibly damaging Het
H2bc7 A T 13: 23,758,231 (GRCm39) V45E possibly damaging Het
Hs3st5 A T 10: 36,704,802 (GRCm39) D35V probably benign Het
Hspa13 T C 16: 75,558,190 (GRCm39) H125R probably benign Het
Hspa1a T G 17: 35,190,156 (GRCm39) H249P probably damaging Het
Igkv10-95 A T 6: 68,657,562 (GRCm39) Q6L probably damaging Het
Il1rap T A 16: 26,533,526 (GRCm39) L474H probably benign Het
Ipo11 T A 13: 107,016,245 (GRCm39) Y489F probably benign Het
Itga5 A G 15: 103,259,259 (GRCm39) Y723H probably damaging Het
Itih2 T C 2: 10,109,971 (GRCm39) N594S probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Kif26b A G 1: 178,506,920 (GRCm39) Y332C probably damaging Het
Kmt2c G A 5: 25,559,382 (GRCm39) R1086W probably damaging Het
Ktn1 T A 14: 47,963,636 (GRCm39) probably benign Het
Lars2 T A 9: 123,247,758 (GRCm39) I305N probably damaging Het
Lgmn G T 12: 102,366,383 (GRCm39) probably benign Het
Ltbp4 C T 7: 27,006,125 (GRCm39) E1453K probably damaging Het
Lypd8 G A 11: 58,277,675 (GRCm39) M152I probably benign Het
Man2a1 T A 17: 65,019,454 (GRCm39) S773T probably benign Het
Map2k6 T G 11: 110,390,300 (GRCm39) L278R probably damaging Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mms19 A G 19: 41,933,935 (GRCm39) V811A possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl1 T A 17: 66,684,882 (GRCm39) H520L probably benign Het
Mymk A T 2: 26,952,719 (GRCm39) F130I probably damaging Het
Myo1f C T 17: 33,801,306 (GRCm39) R333C probably damaging Het
Myo9a T A 9: 59,779,165 (GRCm39) H1640Q probably benign Het
Nav1 A G 1: 135,520,186 (GRCm39) probably benign Het
Ncbp3 G T 11: 72,969,844 (GRCm39) G564C probably damaging Het
Ncoa4 A T 14: 31,898,682 (GRCm39) I501L probably benign Het
Ngp T A 9: 110,249,883 (GRCm39) N60K possibly damaging Het
Npc1l1 G T 11: 6,178,215 (GRCm39) D398E probably damaging Het
Nphs2 T A 1: 156,153,701 (GRCm39) M264K probably damaging Het
Or4s2b G A 2: 88,508,240 (GRCm39) V14I probably benign Het
Or4s2b T G 2: 88,508,523 (GRCm39) V101G probably benign Het
Or7e165 T A 9: 19,694,442 (GRCm39) Y4* probably null Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Pax8 G A 2: 24,311,595 (GRCm39) P447S probably damaging Het
Pde11a A G 2: 75,988,677 (GRCm39) V488A probably benign Het
Pex11g C T 8: 3,515,899 (GRCm39) V45M probably benign Het
Pik3ip1 T A 11: 3,283,327 (GRCm39) S142R probably damaging Het
Pitpnm2 C G 5: 124,263,434 (GRCm39) A819P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plin4 T A 17: 56,412,418 (GRCm39) M538L probably benign Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rev1 T C 1: 38,092,730 (GRCm39) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm39) probably benign Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Sgsm1 A T 5: 113,403,173 (GRCm39) F958Y probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorl1 C T 9: 41,943,210 (GRCm39) V889M possibly damaging Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Stam A T 2: 14,120,669 (GRCm39) H53L probably damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tarbp1 A G 8: 127,201,069 (GRCm39) Y246H probably damaging Het
Tbx15 A G 3: 99,259,683 (GRCm39) Y518C probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tescl T C 7: 24,032,683 (GRCm39) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tmem132d A G 5: 128,061,360 (GRCm39) V414A probably benign Het
Tmem41b T A 7: 109,573,941 (GRCm39) probably benign Het
Tnfrsf18 A G 4: 156,106,337 (GRCm39) probably benign Het
Tulp4 T A 17: 6,249,108 (GRCm39) D42E probably damaging Het
Ubtd1 A G 19: 42,022,103 (GRCm39) N125S probably damaging Het
Ubxn4 T A 1: 128,183,186 (GRCm39) F68I probably benign Het
Urb1 A G 16: 90,573,159 (GRCm39) S958P probably benign Het
Vash2 T C 1: 190,692,498 (GRCm39) S226G probably benign Het
Vmn2r120 C T 17: 57,816,120 (GRCm39) G745E probably damaging Het
Vmn2r58 T A 7: 41,487,117 (GRCm39) I593F probably benign Het
Zfp398 T C 6: 47,817,361 (GRCm39) L67P probably damaging Het
Zfp607b T A 7: 27,403,120 (GRCm39) H525Q probably damaging Het
Zfp629 T C 7: 127,211,492 (GRCm39) T106A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zic5 T A 14: 122,702,212 (GRCm39) D173V probably damaging Het
Zranb2 G A 3: 157,247,521 (GRCm39) probably benign Het
Other mutations in Patz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Patz1 APN 11 3,241,134 (GRCm39) missense probably damaging 1.00
IGL02954:Patz1 APN 11 3,241,761 (GRCm39) missense probably damaging 1.00
IGL02981:Patz1 APN 11 3,240,656 (GRCm39) missense probably damaging 1.00
R0153:Patz1 UTSW 11 3,243,288 (GRCm39) missense probably damaging 1.00
R0758:Patz1 UTSW 11 3,240,879 (GRCm39) missense probably damaging 1.00
R1680:Patz1 UTSW 11 3,257,812 (GRCm39) missense probably damaging 0.96
R1954:Patz1 UTSW 11 3,241,088 (GRCm39) missense probably damaging 0.99
R4964:Patz1 UTSW 11 3,257,720 (GRCm39) missense probably damaging 1.00
R5832:Patz1 UTSW 11 3,256,277 (GRCm39) missense probably benign 0.00
R7172:Patz1 UTSW 11 3,258,032 (GRCm39) missense probably benign
R7454:Patz1 UTSW 11 3,248,297 (GRCm39) start gained probably benign
R8026:Patz1 UTSW 11 3,257,658 (GRCm39) missense probably benign 0.00
R8047:Patz1 UTSW 11 3,256,283 (GRCm39) missense probably benign
R8938:Patz1 UTSW 11 3,240,660 (GRCm39) missense probably damaging 1.00
R8946:Patz1 UTSW 11 3,241,856 (GRCm39) missense probably damaging 1.00
R8965:Patz1 UTSW 11 3,257,815 (GRCm39) missense probably damaging 1.00
R9599:Patz1 UTSW 11 3,240,720 (GRCm39) missense probably benign 0.16
R9664:Patz1 UTSW 11 3,244,562 (GRCm39) missense unknown
Z1177:Patz1 UTSW 11 3,241,751 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGAAGCTGACTGACTCATG -3'
(R):5'- ACAACACAGTCTGCGCAGAG -3'

Sequencing Primer
(F):5'- CTGACTGACTCATGGACAGTG -3'
(R):5'- TCTGCGCAGAGAAGCAAAGTG -3'
Posted On 2015-09-25