Mutagenetix > Incidental Mutation

Incidental Mutation 'R4610:Mrc2'

344637

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

041821-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4610 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105292643-105351139 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 105348431 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

AlphaFold

Q64449

Predicted Effect

probably benign
Transcript: ENSMUST00000021038

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100335

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (121/124)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,970,468	I69N	probably damaging	Het
Aars2	T	A	17: 45,516,921	D555E	probably damaging	Het
Adgre1	C	A	17: 57,450,073	Q777K	possibly damaging	Het
Agpat4	G	A	17: 12,210,377		probably null	Het
Ak7	G	A	12: 105,713,575	V123M	probably benign	Het
Ankle1	AT	A	8: 71,407,207		probably benign	Het
Ankrd44	T	G	1: 54,766,748		probably benign	Het
Aprt	A	T	8: 122,575,415		probably null	Het
Aptx	T	C	4: 40,702,766		probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
AY358078	T	A	14: 51,826,075	C393S	possibly damaging	Het
Bbip1	T	C	19: 53,932,175	M1V	probably null	Het
Cacng7	T	A	7: 3,336,691	M36K	probably benign	Het
Camta1	A	G	4: 151,084,827	W156R	probably damaging	Het
Casd1	G	A	6: 4,631,165		probably null	Het
Casz1	T	A	4: 148,933,267	Y338N	probably damaging	Het
Ccdc66	T	C	14: 27,500,420	N122S	probably damaging	Het
Celf2	G	T	2: 6,586,020	N279K	possibly damaging	Het
Cit	A	G	5: 115,994,087	T1801A	probably benign	Het
Cnot2	A	G	10: 116,499,418	I275T	probably damaging	Het
Ddx4	T	C	13: 112,612,060	K435E	probably damaging	Het
Dnajc6	T	C	4: 101,611,264	F166L	probably damaging	Het
Dst	T	C	1: 34,169,856	L820P	probably damaging	Het
Dusp11	T	A	6: 85,950,055	N193Y	probably damaging	Het
Eif3m	A	T	2: 105,013,288	N116K	probably benign	Het
Epb41l1	A	T	2: 156,509,261	E418D	possibly damaging	Het
Esyt2	T	G	12: 116,318,890	N153K	probably damaging	Het
Exoc6b	T	G	6: 85,003,159		probably benign	Het
Ezr	C	T	17: 6,739,722	E502K	possibly damaging	Het
Fbxw11	T	A	11: 32,711,859	Y66N	possibly damaging	Het
Frem2	A	G	3: 53,547,807	L2116S	possibly damaging	Het
Fry	T	C	5: 150,386,104	L671P	probably damaging	Het
Galnt7	A	G	8: 57,545,769	I262T	probably damaging	Het
Glp1r	T	C	17: 30,931,247	F381S	probably benign	Het
Gm3867	T	C	9: 36,257,271		noncoding transcript	Het
Gm5662	T	C	12: 88,271,774	N72S	probably benign	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Golgb1	A	G	16: 36,918,625	D2442G	probably damaging	Het
Gp1bb	A	T	16: 18,621,143	L67Q	probably damaging	Het
Gstm7	G	A	3: 107,926,919	T206I	possibly damaging	Het
Hist1h2bf	A	T	13: 23,574,057	V45E	possibly damaging	Het
Hs3st5	A	T	10: 36,828,806	D35V	probably benign	Het
Hspa13	T	C	16: 75,761,302	H125R	probably benign	Het
Hspa1a	T	G	17: 34,971,180	H249P	probably damaging	Het
Igkv10-95	A	T	6: 68,680,578	Q6L	probably damaging	Het
Il1rap	T	A	16: 26,714,776	L474H	probably benign	Het
Ipo11	T	A	13: 106,879,737	Y489F	probably benign	Het
Itga5	A	G	15: 103,350,832	Y723H	probably damaging	Het
Itih2	T	C	2: 10,105,160	N594S	probably damaging	Het
Itk	T	A	11: 46,336,515	Q427L	probably benign	Het
Kif26b	A	G	1: 178,679,355	Y332C	probably damaging	Het
Kmt2c	G	A	5: 25,354,384	R1086W	probably damaging	Het
Ktn1	T	A	14: 47,726,179		probably benign	Het
Lars2	T	A	9: 123,418,693	I305N	probably damaging	Het
Lgmn	G	T	12: 102,400,124		probably benign	Het
Ltbp4	C	T	7: 27,306,700	E1453K	probably damaging	Het
Lypd8	G	A	11: 58,386,849	M152I	probably benign	Het
Man2a1	T	A	17: 64,712,459	S773T	probably benign	Het
Map2k6	T	G	11: 110,499,474	L278R	probably damaging	Het
Mbtps1	A	T	8: 119,535,347	D354E	probably damaging	Het
Mcpt9	C	T	14: 56,028,592	V60M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Mms19	A	G	19: 41,945,496	V811A	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mtcl1	T	A	17: 66,377,887	H520L	probably benign	Het
Mymk	A	T	2: 27,062,707	F130I	probably damaging	Het
Myo1f	C	T	17: 33,582,332	R333C	probably damaging	Het
Myo9a	T	A	9: 59,871,882	H1640Q	probably benign	Het
Nav1	A	G	1: 135,592,448		probably benign	Het
Ncbp3	G	T	11: 73,079,018	G564C	probably damaging	Het
Ncoa4	A	T	14: 32,176,725	I501L	probably benign	Het
Ngp	T	A	9: 110,420,815	N60K	possibly damaging	Het
Npc1l1	G	T	11: 6,228,215	D398E	probably damaging	Het
Nphs2	T	A	1: 156,326,131	M264K	probably damaging	Het
Olfr1193	G	A	2: 88,677,896	V14I	probably benign	Het
Olfr1193	T	G	2: 88,678,179	V101G	probably benign	Het
Olfr145	T	A	9: 37,898,326	S307R	probably benign	Het
Olfr58	T	A	9: 19,783,146	Y4*	probably null	Het
Patz1	A	G	11: 3,306,241	Y509C	probably damaging	Het
Pax8	G	A	2: 24,421,583	P447S	probably damaging	Het
Pde11a	A	G	2: 76,158,333	V488A	probably benign	Het
Pex11g	C	T	8: 3,465,899	V45M	probably benign	Het
Pik3ip1	T	A	11: 3,333,327	S142R	probably damaging	Het
Pitpnm2	C	G	5: 124,125,371	A819P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plin4	T	A	17: 56,105,418	M538L	probably benign	Het
Ppp3cb	T	C	14: 20,520,646	N339S	possibly damaging	Het
Rev1	T	C	1: 38,053,649	E1202G	probably damaging	Het
Rngtt	T	A	4: 33,339,133		probably benign	Het
Serpinb12	T	A	1: 106,949,153	D66E	probably benign	Het
Sgsm1	A	T	5: 113,255,307	F958Y	probably damaging	Het
Slc35e2	T	C	4: 155,617,649	F290S	probably benign	Het
Sorl1	C	T	9: 42,031,914	V889M	possibly damaging	Het
Sptlc3	G	A	2: 139,636,680	V520I	probably benign	Het
Stam	A	T	2: 14,115,858	H53L	probably damaging	Het
Stox2	A	G	8: 47,192,935	S497P	probably damaging	Het
Tarbp1	A	G	8: 126,474,330	Y246H	probably damaging	Het
Tbx15	A	G	3: 99,352,367	Y518C	probably damaging	Het
Tdrd5	T	A	1: 156,284,374	T479S	probably benign	Het
Tescl	T	C	7: 24,333,258	E214G	probably damaging	Het
Tex10	T	C	4: 48,452,946	D671G	probably benign	Het
Tmem132d	A	G	5: 127,984,296	V414A	probably benign	Het
Tmem41b	T	A	7: 109,974,734		probably benign	Het
Tnfrsf18	A	G	4: 156,021,880		probably benign	Het
Tulp4	T	A	17: 6,198,833	D42E	probably damaging	Het
Ubtd1	A	G	19: 42,033,664	N125S	probably damaging	Het
Ubxn4	T	A	1: 128,255,449	F68I	probably benign	Het
Urb1	A	G	16: 90,776,271	S958P	probably benign	Het
Vash2	T	C	1: 190,960,301	S226G	probably benign	Het
Vmn2r120	C	T	17: 57,509,120	G745E	probably damaging	Het
Vmn2r58	T	A	7: 41,837,693	I593F	probably benign	Het
Zfp398	T	C	6: 47,840,427	L67P	probably damaging	Het
Zfp607b	T	A	7: 27,703,695	H525Q	probably damaging	Het
Zfp629	T	C	7: 127,612,320	T106A	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zic5	T	A	14: 122,464,800	D173V	probably damaging	Het
Zranb2	G	A	3: 157,541,884		probably benign	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105328741	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105347643	nonsense	probably null
IGL01751:Mrc2	APN	11	105325734	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105336677	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105336707	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105333620	splice site	probably benign
IGL02940:Mrc2	APN	11	105341171	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105325571	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105347866	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105347692	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105340821	missense	probably benign
R1233:Mrc2	UTSW	11	105348415	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105348431	splice site	probably null
R1458:Mrc2	UTSW	11	105337772	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105347725	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105336656	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105338793	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105337720	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105347856	splice site	probably null
R2165:Mrc2	UTSW	11	105348431	splice site	probably null
R2265:Mrc2	UTSW	11	105348431	splice site	probably null
R2266:Mrc2	UTSW	11	105348431	splice site	probably null
R2267:Mrc2	UTSW	11	105348431	splice site	probably null
R2268:Mrc2	UTSW	11	105348431	splice site	probably null
R2269:Mrc2	UTSW	11	105348431	splice site	probably null
R2270:Mrc2	UTSW	11	105348431	splice site	probably null
R2271:Mrc2	UTSW	11	105348431	splice site	probably null
R2272:Mrc2	UTSW	11	105348431	splice site	probably null
R2296:Mrc2	UTSW	11	105348431	splice site	probably null
R2298:Mrc2	UTSW	11	105348431	splice site	probably null
R2300:Mrc2	UTSW	11	105348431	splice site	probably null
R2326:Mrc2	UTSW	11	105348431	splice site	probably null
R2518:Mrc2	UTSW	11	105348431	splice site	probably null
R2519:Mrc2	UTSW	11	105348431	splice site	probably null
R2520:Mrc2	UTSW	11	105348431	splice site	probably null
R2895:Mrc2	UTSW	11	105348431	splice site	probably null
R3029:Mrc2	UTSW	11	105348431	splice site	probably null
R3030:Mrc2	UTSW	11	105348431	splice site	probably null
R3079:Mrc2	UTSW	11	105336713	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105348431	splice site	probably null
R3149:Mrc2	UTSW	11	105348431	splice site	probably null
R3150:Mrc2	UTSW	11	105348431	splice site	probably null
R3420:Mrc2	UTSW	11	105348431	splice site	probably null
R3422:Mrc2	UTSW	11	105348431	splice site	probably null
R3441:Mrc2	UTSW	11	105347716	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105348431	splice site	probably null
R3731:Mrc2	UTSW	11	105348431	splice site	probably null
R3800:Mrc2	UTSW	11	105348431	splice site	probably null
R3820:Mrc2	UTSW	11	105348431	splice site	probably null
R3821:Mrc2	UTSW	11	105348431	splice site	probably null
R3837:Mrc2	UTSW	11	105348431	splice site	probably null
R3838:Mrc2	UTSW	11	105348431	splice site	probably null
R3849:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105347232	splice site	probably benign
R3932:Mrc2	UTSW	11	105348431	splice site	probably null
R3933:Mrc2	UTSW	11	105348431	splice site	probably null
R3971:Mrc2	UTSW	11	105328031	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105348431	splice site	probably null
R4107:Mrc2	UTSW	11	105348431	splice site	probably null
R4113:Mrc2	UTSW	11	105348431	splice site	probably null
R4274:Mrc2	UTSW	11	105348431	splice site	probably null
R4399:Mrc2	UTSW	11	105336658	nonsense	probably null
R4477:Mrc2	UTSW	11	105348431	splice site	probably null
R4478:Mrc2	UTSW	11	105348431	splice site	probably null
R4493:Mrc2	UTSW	11	105348431	splice site	probably null
R4494:Mrc2	UTSW	11	105348431	splice site	probably null
R4495:Mrc2	UTSW	11	105348431	splice site	probably null
R4547:Mrc2	UTSW	11	105336641	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105348431	splice site	probably null
R4601:Mrc2	UTSW	11	105348431	splice site	probably null
R4602:Mrc2	UTSW	11	105348431	splice site	probably null
R4603:Mrc2	UTSW	11	105348431	splice site	probably null
R4611:Mrc2	UTSW	11	105348431	splice site	probably null
R4637:Mrc2	UTSW	11	105348431	splice site	probably null
R4672:Mrc2	UTSW	11	105343097	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105348431	splice site	probably null
R4675:Mrc2	UTSW	11	105348431	splice site	probably null
R4693:Mrc2	UTSW	11	105343702	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105348431	splice site	probably null
R4707:Mrc2	UTSW	11	105348431	splice site	probably null
R4791:Mrc2	UTSW	11	105348431	splice site	probably null
R4792:Mrc2	UTSW	11	105348431	splice site	probably null
R4888:Mrc2	UTSW	11	105341208	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105343582	missense	probably benign
R5600:Mrc2	UTSW	11	105333666	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105336214	nonsense	probably null
R5692:Mrc2	UTSW	11	105336642	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105332343	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105337813	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105346789	missense	probably benign
R6146:Mrc2	UTSW	11	105325644	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105346820	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105349843	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105349882	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105343080	splice site	probably null
R6680:Mrc2	UTSW	11	105325753	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105328418	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105348635	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105332236	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105325803	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105329235	missense	possibly damaging	0.92
R7422:Mrc2	UTSW	11	105292783	start gained	probably benign
R7537:Mrc2	UTSW	11	105292797	missense	probably benign
R7640:Mrc2	UTSW	11	105332295	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105346459	missense	probably benign	0.10
R7885:Mrc2	UTSW	11	105332266	missense	probably damaging	0.98
R7976:Mrc2	UTSW	11	105348003	missense	possibly damaging	0.74
R8042:Mrc2	UTSW	11	105348355	missense	probably damaging	0.98
R8096:Mrc2	UTSW	11	105343507	missense	probably damaging	1.00
R8353:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8453:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8519:Mrc2	UTSW	11	105347306	missense	possibly damaging	0.62
R8771:Mrc2	UTSW	11	105349770	missense	probably benign
R8787:Mrc2	UTSW	11	105347639	missense	probably benign
R8925:Mrc2	UTSW	11	105325508	missense	probably benign	0.00
R8927:Mrc2	UTSW	11	105325508	missense	probably benign	0.00
R8991:Mrc2	UTSW	11	105338914	missense	probably benign
R9017:Mrc2	UTSW	11	105325885	missense	probably damaging	1.00
R9096:Mrc2	UTSW	11	105340572	missense	probably damaging	1.00
R9097:Mrc2	UTSW	11	105340572	missense	probably damaging	1.00
R9223:Mrc2	UTSW	11	105329267	missense	probably damaging	1.00
R9471:Mrc2	UTSW	11	105343733	missense	probably benign	0.03
R9531:Mrc2	UTSW	11	105349905	missense	possibly damaging	0.82
T0970:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105347475	critical splice donor site	probably null
Z1176:Mrc2	UTSW	11	105341376	missense	possibly damaging	0.94
Z1176:Mrc2	UTSW	11	105347360	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGAGCTGCCAGAGAAGAGTG -3'
(R):5'- TGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'

Posted On

2015-09-25