Mutagenetix > Incidental Mutations

Incidental Mutation 'R4610:Ddx4'

344644

Institutional Source

Beutler Lab

Gene Symbol

Ddx4

Ensembl Gene

ENSMUSG00000021758

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 4

Synonyms

Mvh, VASA, mvh / m'vasa

MMRRC Submission

041821-MU

Accession Numbers

Genbank: NM_001145885, NM_010029

Is this an essential gene?

Probably essential (E-score: 0.756) question?

Stock #

R4610 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112598333-112652475 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 112612060 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 435 (K435E)

Ref Sequence

ENSEMBL: ENSMUSP00000075157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075748
AA Change: K435E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: K435E

Domain	Start	End	E-Value	Type
Blast:DEXDc	22	165	8e-14	BLAST
low complexity region	175	183	N/A	INTRINSIC
low complexity region	221	229	N/A	INTRINSIC
DEXDc	280	491	9.38e-59	SMART
HELICc	527	608	1.18e-32	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099166
AA Change: K461E

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: K461E

Domain	Start	End	E-Value	Type
Blast:DEXDc	41	191	7e-25	BLAST
low complexity region	201	209	N/A	INTRINSIC
low complexity region	247	255	N/A	INTRINSIC
DEXDc	306	517	9.38e-59	SMART
HELICc	553	634	1.18e-32	SMART

Meta Mutation Damage Score

0.1913

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (121/124)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,970,468	I69N	probably damaging	Het
Aars2	T	A	17: 45,516,921	D555E	probably damaging	Het
Adgre1	C	A	17: 57,450,073	Q777K	possibly damaging	Het
Agpat4	G	A	17: 12,210,377		probably null	Het
Ak7	G	A	12: 105,713,575	V123M	probably benign	Het
Ankle1	AT	A	8: 71,407,207		probably benign	Het
Ankrd44	T	G	1: 54,766,748		probably benign	Het
Aprt	A	T	8: 122,575,415		probably null	Het
Aptx	T	C	4: 40,702,766		probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
AY358078	T	A	14: 51,826,075	C393S	possibly damaging	Het
Bbip1	T	C	19: 53,932,175	M1V	probably null	Het
Cacng7	T	A	7: 3,336,691	M36K	probably benign	Het
Camta1	A	G	4: 151,084,827	W156R	probably damaging	Het
Casd1	G	A	6: 4,631,165		probably null	Het
Casz1	T	A	4: 148,933,267	Y338N	probably damaging	Het
Ccdc66	T	C	14: 27,500,420	N122S	probably damaging	Het
Celf2	G	T	2: 6,586,020	N279K	possibly damaging	Het
Cit	A	G	5: 115,994,087	T1801A	probably benign	Het
Cnot2	A	G	10: 116,499,418	I275T	probably damaging	Het
Dnajc6	T	C	4: 101,611,264	F166L	probably damaging	Het
Dst	T	C	1: 34,169,856	L820P	probably damaging	Het
Dusp11	T	A	6: 85,950,055	N193Y	probably damaging	Het
Eif3m	A	T	2: 105,013,288	N116K	probably benign	Het
Epb41l1	A	T	2: 156,509,261	E418D	possibly damaging	Het
Esyt2	T	G	12: 116,318,890	N153K	probably damaging	Het
Exoc6b	T	G	6: 85,003,159		probably benign	Het
Ezr	C	T	17: 6,739,722	E502K	possibly damaging	Het
Fbxw11	T	A	11: 32,711,859	Y66N	possibly damaging	Het
Frem2	A	G	3: 53,547,807	L2116S	possibly damaging	Het
Fry	T	C	5: 150,386,104	L671P	probably damaging	Het
Galnt7	A	G	8: 57,545,769	I262T	probably damaging	Het
Glp1r	T	C	17: 30,931,247	F381S	probably benign	Het
Gm3867	T	C	9: 36,257,271		noncoding transcript	Het
Gm5662	T	C	12: 88,271,774	N72S	probably benign	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Golgb1	A	G	16: 36,918,625	D2442G	probably damaging	Het
Gp1bb	A	T	16: 18,621,143	L67Q	probably damaging	Het
Gstm7	G	A	3: 107,926,919	T206I	possibly damaging	Het
Hist1h2bf	A	T	13: 23,574,057	V45E	possibly damaging	Het
Hs3st5	A	T	10: 36,828,806	D35V	probably benign	Het
Hspa13	T	C	16: 75,761,302	H125R	probably benign	Het
Hspa1a	T	G	17: 34,971,180	H249P	probably damaging	Het
Igkv10-95	A	T	6: 68,680,578	Q6L	probably damaging	Het
Il1rap	T	A	16: 26,714,776	L474H	probably benign	Het
Ipo11	T	A	13: 106,879,737	Y489F	probably benign	Het
Itga5	A	G	15: 103,350,832	Y723H	probably damaging	Het
Itih2	T	C	2: 10,105,160	N594S	probably damaging	Het
Itk	T	A	11: 46,336,515	Q427L	probably benign	Het
Kif26b	A	G	1: 178,679,355	Y332C	probably damaging	Het
Kmt2c	G	A	5: 25,354,384	R1086W	probably damaging	Het
Ktn1	T	A	14: 47,726,179		probably benign	Het
Lars2	T	A	9: 123,418,693	I305N	probably damaging	Het
Lgmn	G	T	12: 102,400,124		probably benign	Het
Ltbp4	C	T	7: 27,306,700	E1453K	probably damaging	Het
Lypd8	G	A	11: 58,386,849	M152I	probably benign	Het
Man2a1	T	A	17: 64,712,459	S773T	probably benign	Het
Map2k6	T	G	11: 110,499,474	L278R	probably damaging	Het
Mbtps1	A	T	8: 119,535,347	D354E	probably damaging	Het
Mcpt9	C	T	14: 56,028,592	V60M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Mms19	A	G	19: 41,945,496	V811A	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mtcl1	T	A	17: 66,377,887	H520L	probably benign	Het
Mymk	A	T	2: 27,062,707	F130I	probably damaging	Het
Myo1f	C	T	17: 33,582,332	R333C	probably damaging	Het
Myo9a	T	A	9: 59,871,882	H1640Q	probably benign	Het
Nav1	A	G	1: 135,592,448		probably benign	Het
Ncbp3	G	T	11: 73,079,018	G564C	probably damaging	Het
Ncoa4	A	T	14: 32,176,725	I501L	probably benign	Het
Ngp	T	A	9: 110,420,815	N60K	possibly damaging	Het
Npc1l1	G	T	11: 6,228,215	D398E	probably damaging	Het
Nphs2	T	A	1: 156,326,131	M264K	probably damaging	Het
Olfr1193	G	A	2: 88,677,896	V14I	probably benign	Het
Olfr1193	T	G	2: 88,678,179	V101G	probably benign	Het
Olfr145	T	A	9: 37,898,326	S307R	probably benign	Het
Olfr58	T	A	9: 19,783,146	Y4*	probably null	Het
Patz1	A	G	11: 3,306,241	Y509C	probably damaging	Het
Pax8	G	A	2: 24,421,583	P447S	probably damaging	Het
Pde11a	A	G	2: 76,158,333	V488A	probably benign	Het
Pex11g	C	T	8: 3,465,899	V45M	probably benign	Het
Pik3ip1	T	A	11: 3,333,327	S142R	probably damaging	Het
Pitpnm2	C	G	5: 124,125,371	A819P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plin4	T	A	17: 56,105,418	M538L	probably benign	Het
Ppp3cb	T	C	14: 20,520,646	N339S	possibly damaging	Het
Rev1	T	C	1: 38,053,649	E1202G	probably damaging	Het
Rngtt	T	A	4: 33,339,133		probably benign	Het
Serpinb12	T	A	1: 106,949,153	D66E	probably benign	Het
Sgsm1	A	T	5: 113,255,307	F958Y	probably damaging	Het
Slc35e2	T	C	4: 155,617,649	F290S	probably benign	Het
Sorl1	C	T	9: 42,031,914	V889M	possibly damaging	Het
Sptlc3	G	A	2: 139,636,680	V520I	probably benign	Het
Stam	A	T	2: 14,115,858	H53L	probably damaging	Het
Stox2	A	G	8: 47,192,935	S497P	probably damaging	Het
Tarbp1	A	G	8: 126,474,330	Y246H	probably damaging	Het
Tbx15	A	G	3: 99,352,367	Y518C	probably damaging	Het
Tdrd5	T	A	1: 156,284,374	T479S	probably benign	Het
Tescl	T	C	7: 24,333,258	E214G	probably damaging	Het
Tex10	T	C	4: 48,452,946	D671G	probably benign	Het
Tmem132d	A	G	5: 127,984,296	V414A	probably benign	Het
Tmem41b	T	A	7: 109,974,734		probably benign	Het
Tnfrsf18	A	G	4: 156,021,880		probably benign	Het
Tulp4	T	A	17: 6,198,833	D42E	probably damaging	Het
Ubtd1	A	G	19: 42,033,664	N125S	probably damaging	Het
Ubxn4	T	A	1: 128,255,449	F68I	probably benign	Het
Urb1	A	G	16: 90,776,271	S958P	probably benign	Het
Vash2	T	C	1: 190,960,301	S226G	probably benign	Het
Vmn2r120	C	T	17: 57,509,120	G745E	probably damaging	Het
Vmn2r58	T	A	7: 41,837,693	I593F	probably benign	Het
Zfp398	T	C	6: 47,840,427	L67P	probably damaging	Het
Zfp607b	T	A	7: 27,703,695	H525Q	probably damaging	Het
Zfp629	T	C	7: 127,612,320	T106A	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zic5	T	A	14: 122,464,800	D173V	probably damaging	Het
Zranb2	G	A	3: 157,541,884		probably benign	Het

Other mutations in Ddx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02030:Ddx4	APN	13	112624777	splice site	probably benign
IGL02682:Ddx4	APN	13	112622186	missense	probably benign	0.04
IGL02729:Ddx4	APN	13	112651412	utr 5 prime	probably benign
H8930:Ddx4	UTSW	13	112613833	splice site	probably null
R0518:Ddx4	UTSW	13	112624779	critical splice donor site	probably null
R0521:Ddx4	UTSW	13	112624779	critical splice donor site	probably null
R1527:Ddx4	UTSW	13	112622239	missense	possibly damaging	0.95
R1548:Ddx4	UTSW	13	112599997	missense	probably damaging	1.00
R1773:Ddx4	UTSW	13	112599902	missense	probably benign
R1886:Ddx4	UTSW	13	112622665	missense	probably damaging	1.00
R1969:Ddx4	UTSW	13	112600013	missense	probably damaging	0.99
R1969:Ddx4	UTSW	13	112620742	missense	probably damaging	0.99
R1970:Ddx4	UTSW	13	112600013	missense	probably damaging	0.99
R1971:Ddx4	UTSW	13	112600013	missense	probably damaging	0.99
R2265:Ddx4	UTSW	13	112621276	missense	probably benign	0.08
R2280:Ddx4	UTSW	13	112620656	missense	probably benign	0.03
R2846:Ddx4	UTSW	13	112604612	missense	probably damaging	0.99
R2906:Ddx4	UTSW	13	112620777	splice site	probably benign
R2980:Ddx4	UTSW	13	112612085	missense	probably damaging	1.00
R3732:Ddx4	UTSW	13	112611982	missense	possibly damaging	0.56
R4085:Ddx4	UTSW	13	112613761	missense	probably benign	0.05
R4088:Ddx4	UTSW	13	112613761	missense	probably benign	0.05
R4089:Ddx4	UTSW	13	112613761	missense	probably benign	0.05
R4090:Ddx4	UTSW	13	112613761	missense	probably benign	0.05
R4600:Ddx4	UTSW	13	112612060	missense	probably damaging	1.00
R4669:Ddx4	UTSW	13	112622244	missense	probably damaging	1.00
R4700:Ddx4	UTSW	13	112613735	missense	probably damaging	1.00
R4782:Ddx4	UTSW	13	112613696	critical splice donor site	probably null
R4782:Ddx4	UTSW	13	112651360	missense	probably benign	0.10
R5326:Ddx4	UTSW	13	112621245	missense	probably damaging	1.00
R5542:Ddx4	UTSW	13	112621245	missense	probably damaging	1.00
R6111:Ddx4	UTSW	13	112621232	nonsense	probably null
R6253:Ddx4	UTSW	13	112636022	nonsense	probably null
R6253:Ddx4	UTSW	13	112636023	missense	probably benign	0.00
R6286:Ddx4	UTSW	13	112613735	missense	probably damaging	1.00
R6518:Ddx4	UTSW	13	112604547	missense	probably benign
R6645:Ddx4	UTSW	13	112641174	missense	possibly damaging	0.70
R7017:Ddx4	UTSW	13	112601488	missense	probably damaging	1.00
R7155:Ddx4	UTSW	13	112613785	missense	probably benign	0.01
R7822:Ddx4	UTSW	13	112612113	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGTGCATAGGGAGGCCAG -3'
(R):5'- GAGGTGTTCTTCCCAGCTGA -3'

Sequencing Primer
(F):5'- ACTGAAATCTGGGATCTGCC -3'
(R):5'- CCCAGCTGATTCTAGTTGTGTCAAG -3'

Posted On

2015-09-25