Incidental Mutation 'R4610:Ddx4'
ID 344644
Institutional Source Beutler Lab
Gene Symbol Ddx4
Ensembl Gene ENSMUSG00000021758
Gene Name DEAD box helicase 4
Synonyms VASA, mvh / m'vasa, DEAD (Asp-Glu-Ala-Asp) box polypeptide 4, Mvh
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.638) question?
Stock # R4610 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 112734867-112789009 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112748594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 435 (K435E)
Ref Sequence ENSEMBL: ENSMUSP00000075157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]
AlphaFold Q61496
Predicted Effect probably damaging
Transcript: ENSMUST00000075748
AA Change: K435E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: K435E

DomainStartEndE-ValueType
Blast:DEXDc 22 165 8e-14 BLAST
low complexity region 175 183 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
DEXDc 280 491 9.38e-59 SMART
HELICc 527 608 1.18e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099166
AA Change: K461E

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: K461E

DomainStartEndE-ValueType
Blast:DEXDc 41 191 7e-25 BLAST
low complexity region 201 209 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
DEXDc 306 517 9.38e-59 SMART
HELICc 553 634 1.18e-32 SMART
Meta Mutation Damage Score 0.1913 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Adgre1 C A 17: 57,757,073 (GRCm39) Q777K possibly damaging Het
Agpat4 G A 17: 12,429,264 (GRCm39) probably null Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Ankle1 AT A 8: 71,859,851 (GRCm39) probably benign Het
Ankrd44 T G 1: 54,805,907 (GRCm39) probably benign Het
Aprt A T 8: 123,302,154 (GRCm39) probably null Het
Aptx T C 4: 40,702,766 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Cacng7 T A 7: 3,385,207 (GRCm39) M36K probably benign Het
Camta1 A G 4: 151,169,284 (GRCm39) W156R probably damaging Het
Casd1 G A 6: 4,631,165 (GRCm39) probably null Het
Casz1 T A 4: 149,017,724 (GRCm39) Y338N probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cit A G 5: 116,132,146 (GRCm39) T1801A probably benign Het
Cnot2 A G 10: 116,335,323 (GRCm39) I275T probably damaging Het
Dnajc6 T C 4: 101,468,461 (GRCm39) F166L probably damaging Het
Dst T C 1: 34,208,937 (GRCm39) L820P probably damaging Het
Dusp11 T A 6: 85,927,037 (GRCm39) N193Y probably damaging Het
Eif1ad7 T C 12: 88,238,544 (GRCm39) N72S probably benign Het
Eif3m A T 2: 104,843,633 (GRCm39) N116K probably benign Het
Epb41l1 A T 2: 156,351,181 (GRCm39) E418D possibly damaging Het
Esyt2 T G 12: 116,282,510 (GRCm39) N153K probably damaging Het
Exoc6b T G 6: 84,980,141 (GRCm39) probably benign Het
Ezr C T 17: 7,007,121 (GRCm39) E502K possibly damaging Het
Fbxw11 T A 11: 32,661,859 (GRCm39) Y66N possibly damaging Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Fry T C 5: 150,309,569 (GRCm39) L671P probably damaging Het
Galnt7 A G 8: 57,998,803 (GRCm39) I262T probably damaging Het
Glp1r T C 17: 31,150,221 (GRCm39) F381S probably benign Het
Gm3867 T C 9: 36,168,567 (GRCm39) noncoding transcript Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Gp1bb A T 16: 18,439,893 (GRCm39) L67Q probably damaging Het
Gstm7 G A 3: 107,834,235 (GRCm39) T206I possibly damaging Het
H2bc7 A T 13: 23,758,231 (GRCm39) V45E possibly damaging Het
Hs3st5 A T 10: 36,704,802 (GRCm39) D35V probably benign Het
Hspa13 T C 16: 75,558,190 (GRCm39) H125R probably benign Het
Hspa1a T G 17: 35,190,156 (GRCm39) H249P probably damaging Het
Igkv10-95 A T 6: 68,657,562 (GRCm39) Q6L probably damaging Het
Il1rap T A 16: 26,533,526 (GRCm39) L474H probably benign Het
Ipo11 T A 13: 107,016,245 (GRCm39) Y489F probably benign Het
Itga5 A G 15: 103,259,259 (GRCm39) Y723H probably damaging Het
Itih2 T C 2: 10,109,971 (GRCm39) N594S probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Kif26b A G 1: 178,506,920 (GRCm39) Y332C probably damaging Het
Kmt2c G A 5: 25,559,382 (GRCm39) R1086W probably damaging Het
Ktn1 T A 14: 47,963,636 (GRCm39) probably benign Het
Lars2 T A 9: 123,247,758 (GRCm39) I305N probably damaging Het
Lgmn G T 12: 102,366,383 (GRCm39) probably benign Het
Ltbp4 C T 7: 27,006,125 (GRCm39) E1453K probably damaging Het
Lypd8 G A 11: 58,277,675 (GRCm39) M152I probably benign Het
Man2a1 T A 17: 65,019,454 (GRCm39) S773T probably benign Het
Map2k6 T G 11: 110,390,300 (GRCm39) L278R probably damaging Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mms19 A G 19: 41,933,935 (GRCm39) V811A possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl1 T A 17: 66,684,882 (GRCm39) H520L probably benign Het
Mymk A T 2: 26,952,719 (GRCm39) F130I probably damaging Het
Myo1f C T 17: 33,801,306 (GRCm39) R333C probably damaging Het
Myo9a T A 9: 59,779,165 (GRCm39) H1640Q probably benign Het
Nav1 A G 1: 135,520,186 (GRCm39) probably benign Het
Ncbp3 G T 11: 72,969,844 (GRCm39) G564C probably damaging Het
Ncoa4 A T 14: 31,898,682 (GRCm39) I501L probably benign Het
Ngp T A 9: 110,249,883 (GRCm39) N60K possibly damaging Het
Npc1l1 G T 11: 6,178,215 (GRCm39) D398E probably damaging Het
Nphs2 T A 1: 156,153,701 (GRCm39) M264K probably damaging Het
Or4s2b T G 2: 88,508,523 (GRCm39) V101G probably benign Het
Or4s2b G A 2: 88,508,240 (GRCm39) V14I probably benign Het
Or7e165 T A 9: 19,694,442 (GRCm39) Y4* probably null Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Patz1 A G 11: 3,256,241 (GRCm39) Y509C probably damaging Het
Pax8 G A 2: 24,311,595 (GRCm39) P447S probably damaging Het
Pde11a A G 2: 75,988,677 (GRCm39) V488A probably benign Het
Pex11g C T 8: 3,515,899 (GRCm39) V45M probably benign Het
Pik3ip1 T A 11: 3,283,327 (GRCm39) S142R probably damaging Het
Pitpnm2 C G 5: 124,263,434 (GRCm39) A819P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plin4 T A 17: 56,412,418 (GRCm39) M538L probably benign Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rev1 T C 1: 38,092,730 (GRCm39) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm39) probably benign Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Sgsm1 A T 5: 113,403,173 (GRCm39) F958Y probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorl1 C T 9: 41,943,210 (GRCm39) V889M possibly damaging Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Stam A T 2: 14,120,669 (GRCm39) H53L probably damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tarbp1 A G 8: 127,201,069 (GRCm39) Y246H probably damaging Het
Tbx15 A G 3: 99,259,683 (GRCm39) Y518C probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tescl T C 7: 24,032,683 (GRCm39) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tmem132d A G 5: 128,061,360 (GRCm39) V414A probably benign Het
Tmem41b T A 7: 109,573,941 (GRCm39) probably benign Het
Tnfrsf18 A G 4: 156,106,337 (GRCm39) probably benign Het
Tulp4 T A 17: 6,249,108 (GRCm39) D42E probably damaging Het
Ubtd1 A G 19: 42,022,103 (GRCm39) N125S probably damaging Het
Ubxn4 T A 1: 128,183,186 (GRCm39) F68I probably benign Het
Urb1 A G 16: 90,573,159 (GRCm39) S958P probably benign Het
Vash2 T C 1: 190,692,498 (GRCm39) S226G probably benign Het
Vmn2r120 C T 17: 57,816,120 (GRCm39) G745E probably damaging Het
Vmn2r58 T A 7: 41,487,117 (GRCm39) I593F probably benign Het
Zfp398 T C 6: 47,817,361 (GRCm39) L67P probably damaging Het
Zfp607b T A 7: 27,403,120 (GRCm39) H525Q probably damaging Het
Zfp629 T C 7: 127,211,492 (GRCm39) T106A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zic5 T A 14: 122,702,212 (GRCm39) D173V probably damaging Het
Zranb2 G A 3: 157,247,521 (GRCm39) probably benign Het
Other mutations in Ddx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx4 APN 13 112,761,311 (GRCm39) splice site probably benign
IGL02682:Ddx4 APN 13 112,758,720 (GRCm39) missense probably benign 0.04
IGL02729:Ddx4 APN 13 112,787,946 (GRCm39) utr 5 prime probably benign
H8930:Ddx4 UTSW 13 112,750,367 (GRCm39) splice site probably null
R0518:Ddx4 UTSW 13 112,761,313 (GRCm39) critical splice donor site probably null
R0521:Ddx4 UTSW 13 112,761,313 (GRCm39) critical splice donor site probably null
R1527:Ddx4 UTSW 13 112,758,773 (GRCm39) missense possibly damaging 0.95
R1548:Ddx4 UTSW 13 112,736,531 (GRCm39) missense probably damaging 1.00
R1773:Ddx4 UTSW 13 112,736,436 (GRCm39) missense probably benign
R1886:Ddx4 UTSW 13 112,759,199 (GRCm39) missense probably damaging 1.00
R1969:Ddx4 UTSW 13 112,757,276 (GRCm39) missense probably damaging 0.99
R1969:Ddx4 UTSW 13 112,736,547 (GRCm39) missense probably damaging 0.99
R1970:Ddx4 UTSW 13 112,736,547 (GRCm39) missense probably damaging 0.99
R1971:Ddx4 UTSW 13 112,736,547 (GRCm39) missense probably damaging 0.99
R2265:Ddx4 UTSW 13 112,757,810 (GRCm39) missense probably benign 0.08
R2280:Ddx4 UTSW 13 112,757,190 (GRCm39) missense probably benign 0.03
R2846:Ddx4 UTSW 13 112,741,146 (GRCm39) missense probably damaging 0.99
R2906:Ddx4 UTSW 13 112,757,311 (GRCm39) splice site probably benign
R2980:Ddx4 UTSW 13 112,748,619 (GRCm39) missense probably damaging 1.00
R3732:Ddx4 UTSW 13 112,748,516 (GRCm39) missense possibly damaging 0.56
R4085:Ddx4 UTSW 13 112,750,295 (GRCm39) missense probably benign 0.05
R4088:Ddx4 UTSW 13 112,750,295 (GRCm39) missense probably benign 0.05
R4089:Ddx4 UTSW 13 112,750,295 (GRCm39) missense probably benign 0.05
R4090:Ddx4 UTSW 13 112,750,295 (GRCm39) missense probably benign 0.05
R4600:Ddx4 UTSW 13 112,748,594 (GRCm39) missense probably damaging 1.00
R4669:Ddx4 UTSW 13 112,758,778 (GRCm39) missense probably damaging 1.00
R4700:Ddx4 UTSW 13 112,750,269 (GRCm39) missense probably damaging 1.00
R4782:Ddx4 UTSW 13 112,787,894 (GRCm39) missense probably benign 0.10
R4782:Ddx4 UTSW 13 112,750,230 (GRCm39) critical splice donor site probably null
R5326:Ddx4 UTSW 13 112,757,779 (GRCm39) missense probably damaging 1.00
R5542:Ddx4 UTSW 13 112,757,779 (GRCm39) missense probably damaging 1.00
R6111:Ddx4 UTSW 13 112,757,766 (GRCm39) nonsense probably null
R6253:Ddx4 UTSW 13 112,772,557 (GRCm39) missense probably benign 0.00
R6253:Ddx4 UTSW 13 112,772,556 (GRCm39) nonsense probably null
R6286:Ddx4 UTSW 13 112,750,269 (GRCm39) missense probably damaging 1.00
R6518:Ddx4 UTSW 13 112,741,081 (GRCm39) missense probably benign
R6645:Ddx4 UTSW 13 112,777,708 (GRCm39) missense possibly damaging 0.70
R7017:Ddx4 UTSW 13 112,738,022 (GRCm39) missense probably damaging 1.00
R7155:Ddx4 UTSW 13 112,750,319 (GRCm39) missense probably benign 0.01
R7822:Ddx4 UTSW 13 112,748,647 (GRCm39) missense probably damaging 1.00
R7921:Ddx4 UTSW 13 112,738,041 (GRCm39) missense probably benign
R8041:Ddx4 UTSW 13 112,762,928 (GRCm39) missense probably benign
R8048:Ddx4 UTSW 13 112,758,706 (GRCm39) missense probably null 1.00
R8939:Ddx4 UTSW 13 112,758,823 (GRCm39) missense probably benign 0.21
R9325:Ddx4 UTSW 13 112,736,441 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTGTGCATAGGGAGGCCAG -3'
(R):5'- GAGGTGTTCTTCCCAGCTGA -3'

Sequencing Primer
(F):5'- ACTGAAATCTGGGATCTGCC -3'
(R):5'- CCCAGCTGATTCTAGTTGTGTCAAG -3'
Posted On 2015-09-25