Incidental Mutation 'R4610:Gp1bb'
ID344653
Institutional Source Beutler Lab
Gene Symbol Gp1bb
Ensembl Gene ENSMUSG00000050761
Gene Nameglycoprotein Ib, beta polypeptide
Synonyms
MMRRC Submission 041821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4610 (G1)
Quality Score150
Status Validated
Chromosome16
Chromosomal Location18620317-18622403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18621143 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 67 (L67Q)
Ref Sequence ENSEMBL: ENSMUSP00000126292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051160] [ENSMUST00000096987] [ENSMUST00000167388] [ENSMUST00000231244] [ENSMUST00000231335] [ENSMUST00000231622] [ENSMUST00000231956] [ENSMUST00000232653]
Predicted Effect probably damaging
Transcript: ENSMUST00000051160
AA Change: L75Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059270
Gene: ENSMUSG00000050761
AA Change: L75Q

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
LRRNT 33 67 4.14e-11 SMART
low complexity region 75 94 N/A INTRINSIC
LRRCT 97 150 4.88e-14 SMART
transmembrane domain 159 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096987
SMART Domains Protein: ENSMUSP00000094750
Gene: ENSMUSG00000072214

DomainStartEndE-ValueType
Pfam:Septin 41 321 1.2e-127 PFAM
Pfam:MMR_HSR1 46 190 5.1e-7 PFAM
low complexity region 355 369 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167388
AA Change: L67Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126292
Gene: ENSMUSG00000050761
AA Change: L67Q

DomainStartEndE-ValueType
LRRNT 25 59 4.14e-11 SMART
low complexity region 67 86 N/A INTRINSIC
LRRCT 89 142 4.88e-14 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231246
Predicted Effect probably benign
Transcript: ENSMUST00000231335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231400
Predicted Effect probably benign
Transcript: ENSMUST00000231622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231642
Predicted Effect probably benign
Transcript: ENSMUST00000231956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232152
Predicted Effect probably benign
Transcript: ENSMUST00000232653
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Platelet glycoprotein Ib (GPIb) is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. It is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (VWF), and mediates platelet adhesion in the arterial circulation. GPIb alpha chain provides the VWF binding site, and GPIb beta contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. Mutations in the GPIb beta subunit have been associated with Bernard-Soulier syndrome, velocardiofacial syndrome and giant platelet disorder. The 206 amino acid precursor of GPIb beta is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. A 411 amino acid protein arising from a longer, unspliced transcript in endothelial cells has been described; however, the authenticity of this product has been questioned. Yet another less abundant GPIb beta mRNA species of 3.5 kb, expressed in nonhematopoietic tissues such as endothelium, brain and heart, was shown to result from inefficient usage of a non-consensus polyA signal in the neighboring upstream gene (SEPT5, septin 5). In the absence of polyadenylation from its own imperfect site, the SEPT5 gene produces read-through transcripts that use the consensus polyA signal of this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a significantly smaller than normal number of abnormally large platelets. They also display a severe bleeding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Adgre1 C A 17: 57,450,073 Q777K possibly damaging Het
Agpat4 G A 17: 12,210,377 probably null Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankle1 AT A 8: 71,407,207 probably benign Het
Ankrd44 T G 1: 54,766,748 probably benign Het
Aprt A T 8: 122,575,415 probably null Het
Aptx T C 4: 40,702,766 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Cacng7 T A 7: 3,336,691 M36K probably benign Het
Camta1 A G 4: 151,084,827 W156R probably damaging Het
Casd1 G A 6: 4,631,165 probably null Het
Casz1 T A 4: 148,933,267 Y338N probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cit A G 5: 115,994,087 T1801A probably benign Het
Cnot2 A G 10: 116,499,418 I275T probably damaging Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dst T C 1: 34,169,856 L820P probably damaging Het
Dusp11 T A 6: 85,950,055 N193Y probably damaging Het
Eif3m A T 2: 105,013,288 N116K probably benign Het
Epb41l1 A T 2: 156,509,261 E418D possibly damaging Het
Esyt2 T G 12: 116,318,890 N153K probably damaging Het
Exoc6b T G 6: 85,003,159 probably benign Het
Ezr C T 17: 6,739,722 E502K possibly damaging Het
Fbxw11 T A 11: 32,711,859 Y66N possibly damaging Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Fry T C 5: 150,386,104 L671P probably damaging Het
Galnt7 A G 8: 57,545,769 I262T probably damaging Het
Glp1r T C 17: 30,931,247 F381S probably benign Het
Gm3867 T C 9: 36,257,271 noncoding transcript Het
Gm5662 T C 12: 88,271,774 N72S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Gstm7 G A 3: 107,926,919 T206I possibly damaging Het
Hist1h2bf A T 13: 23,574,057 V45E possibly damaging Het
Hs3st5 A T 10: 36,828,806 D35V probably benign Het
Hspa13 T C 16: 75,761,302 H125R probably benign Het
Hspa1a T G 17: 34,971,180 H249P probably damaging Het
Igkv10-95 A T 6: 68,680,578 Q6L probably damaging Het
Il1rap T A 16: 26,714,776 L474H probably benign Het
Ipo11 T A 13: 106,879,737 Y489F probably benign Het
Itga5 A G 15: 103,350,832 Y723H probably damaging Het
Itih2 T C 2: 10,105,160 N594S probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Kif26b A G 1: 178,679,355 Y332C probably damaging Het
Kmt2c G A 5: 25,354,384 R1086W probably damaging Het
Ktn1 T A 14: 47,726,179 probably benign Het
Lars2 T A 9: 123,418,693 I305N probably damaging Het
Lgmn G T 12: 102,400,124 probably benign Het
Ltbp4 C T 7: 27,306,700 E1453K probably damaging Het
Lypd8 G A 11: 58,386,849 M152I probably benign Het
Man2a1 T A 17: 64,712,459 S773T probably benign Het
Map2k6 T G 11: 110,499,474 L278R probably damaging Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mms19 A G 19: 41,945,496 V811A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtcl1 T A 17: 66,377,887 H520L probably benign Het
Mymk A T 2: 27,062,707 F130I probably damaging Het
Myo1f C T 17: 33,582,332 R333C probably damaging Het
Myo9a T A 9: 59,871,882 H1640Q probably benign Het
Nav1 A G 1: 135,592,448 probably benign Het
Ncbp3 G T 11: 73,079,018 G564C probably damaging Het
Ncoa4 A T 14: 32,176,725 I501L probably benign Het
Ngp T A 9: 110,420,815 N60K possibly damaging Het
Npc1l1 G T 11: 6,228,215 D398E probably damaging Het
Nphs2 T A 1: 156,326,131 M264K probably damaging Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr58 T A 9: 19,783,146 Y4* probably null Het
Patz1 A G 11: 3,306,241 Y509C probably damaging Het
Pax8 G A 2: 24,421,583 P447S probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Pex11g C T 8: 3,465,899 V45M probably benign Het
Pik3ip1 T A 11: 3,333,327 S142R probably damaging Het
Pitpnm2 C G 5: 124,125,371 A819P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plin4 T A 17: 56,105,418 M538L probably benign Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rev1 T C 1: 38,053,649 E1202G probably damaging Het
Rngtt T A 4: 33,339,133 probably benign Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgsm1 A T 5: 113,255,307 F958Y probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorl1 C T 9: 42,031,914 V889M possibly damaging Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stam A T 2: 14,115,858 H53L probably damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tarbp1 A G 8: 126,474,330 Y246H probably damaging Het
Tbx15 A G 3: 99,352,367 Y518C probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tescl T C 7: 24,333,258 E214G probably damaging Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tmem132d A G 5: 127,984,296 V414A probably benign Het
Tmem41b T A 7: 109,974,734 probably benign Het
Tnfrsf18 A G 4: 156,021,880 probably benign Het
Tulp4 T A 17: 6,198,833 D42E probably damaging Het
Ubtd1 A G 19: 42,033,664 N125S probably damaging Het
Ubxn4 T A 1: 128,255,449 F68I probably benign Het
Urb1 A G 16: 90,776,271 S958P probably benign Het
Vash2 T C 1: 190,960,301 S226G probably benign Het
Vmn2r120 C T 17: 57,509,120 G745E probably damaging Het
Vmn2r58 T A 7: 41,837,693 I593F probably benign Het
Zfp398 T C 6: 47,840,427 L67P probably damaging Het
Zfp607b T A 7: 27,703,695 H525Q probably damaging Het
Zfp629 T C 7: 127,612,320 T106A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zic5 T A 14: 122,464,800 D173V probably damaging Het
Zranb2 G A 3: 157,541,884 probably benign Het
Other mutations in Gp1bb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Gp1bb APN 16 18620900 missense possibly damaging 0.79
IGL02956:Gp1bb APN 16 18620925 missense probably benign 0.06
R4603:Gp1bb UTSW 16 18621143 missense probably damaging 1.00
R7007:Gp1bb UTSW 16 18620939 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CGACCTAGTAGAAGTGCCAATAG -3'
(R):5'- AGTGCTTCTCTTTCAGGGC -3'

Sequencing Primer
(F):5'- CAATAGCAGCGCGTGTAGC -3'
(R):5'- TCTTTCAGGGCCCCGTG -3'
Posted On2015-09-25