Incidental Mutation 'R4610:Gp1bb'
ID 344653
Institutional Source Beutler Lab
Gene Symbol Gp1bb
Ensembl Gene ENSMUSG00000050761
Gene Name glycoprotein Ib, beta polypeptide
Synonyms
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4610 (G1)
Quality Score 150
Status Validated
Chromosome 16
Chromosomal Location 18439069-18441153 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18439893 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 67 (L67Q)
Ref Sequence ENSEMBL: ENSMUSP00000126292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051160] [ENSMUST00000096987] [ENSMUST00000167388] [ENSMUST00000231244] [ENSMUST00000231335] [ENSMUST00000231622] [ENSMUST00000232653] [ENSMUST00000231956]
AlphaFold P56400
Predicted Effect probably damaging
Transcript: ENSMUST00000051160
AA Change: L75Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059270
Gene: ENSMUSG00000050761
AA Change: L75Q

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
LRRNT 33 67 4.14e-11 SMART
low complexity region 75 94 N/A INTRINSIC
LRRCT 97 150 4.88e-14 SMART
transmembrane domain 159 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096987
SMART Domains Protein: ENSMUSP00000094750
Gene: ENSMUSG00000072214

DomainStartEndE-ValueType
Pfam:Septin 41 321 1.2e-127 PFAM
Pfam:MMR_HSR1 46 190 5.1e-7 PFAM
low complexity region 355 369 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167388
AA Change: L67Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126292
Gene: ENSMUSG00000050761
AA Change: L67Q

DomainStartEndE-ValueType
LRRNT 25 59 4.14e-11 SMART
low complexity region 67 86 N/A INTRINSIC
LRRCT 89 142 4.88e-14 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231246
Predicted Effect probably benign
Transcript: ENSMUST00000231335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231400
Predicted Effect probably benign
Transcript: ENSMUST00000231622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231642
Predicted Effect probably benign
Transcript: ENSMUST00000232653
Predicted Effect probably benign
Transcript: ENSMUST00000231956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232152
Meta Mutation Damage Score 0.9021 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Platelet glycoprotein Ib (GPIb) is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. It is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (VWF), and mediates platelet adhesion in the arterial circulation. GPIb alpha chain provides the VWF binding site, and GPIb beta contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. Mutations in the GPIb beta subunit have been associated with Bernard-Soulier syndrome, velocardiofacial syndrome and giant platelet disorder. The 206 amino acid precursor of GPIb beta is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. A 411 amino acid protein arising from a longer, unspliced transcript in endothelial cells has been described; however, the authenticity of this product has been questioned. Yet another less abundant GPIb beta mRNA species of 3.5 kb, expressed in nonhematopoietic tissues such as endothelium, brain and heart, was shown to result from inefficient usage of a non-consensus polyA signal in the neighboring upstream gene (SEPT5, septin 5). In the absence of polyadenylation from its own imperfect site, the SEPT5 gene produces read-through transcripts that use the consensus polyA signal of this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a significantly smaller than normal number of abnormally large platelets. They also display a severe bleeding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Adgre1 C A 17: 57,757,073 (GRCm39) Q777K possibly damaging Het
Agpat4 G A 17: 12,429,264 (GRCm39) probably null Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Ankle1 AT A 8: 71,859,851 (GRCm39) probably benign Het
Ankrd44 T G 1: 54,805,907 (GRCm39) probably benign Het
Aprt A T 8: 123,302,154 (GRCm39) probably null Het
Aptx T C 4: 40,702,766 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Cacng7 T A 7: 3,385,207 (GRCm39) M36K probably benign Het
Camta1 A G 4: 151,169,284 (GRCm39) W156R probably damaging Het
Casd1 G A 6: 4,631,165 (GRCm39) probably null Het
Casz1 T A 4: 149,017,724 (GRCm39) Y338N probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cit A G 5: 116,132,146 (GRCm39) T1801A probably benign Het
Cnot2 A G 10: 116,335,323 (GRCm39) I275T probably damaging Het
Ddx4 T C 13: 112,748,594 (GRCm39) K435E probably damaging Het
Dnajc6 T C 4: 101,468,461 (GRCm39) F166L probably damaging Het
Dst T C 1: 34,208,937 (GRCm39) L820P probably damaging Het
Dusp11 T A 6: 85,927,037 (GRCm39) N193Y probably damaging Het
Eif1ad7 T C 12: 88,238,544 (GRCm39) N72S probably benign Het
Eif3m A T 2: 104,843,633 (GRCm39) N116K probably benign Het
Epb41l1 A T 2: 156,351,181 (GRCm39) E418D possibly damaging Het
Esyt2 T G 12: 116,282,510 (GRCm39) N153K probably damaging Het
Exoc6b T G 6: 84,980,141 (GRCm39) probably benign Het
Ezr C T 17: 7,007,121 (GRCm39) E502K possibly damaging Het
Fbxw11 T A 11: 32,661,859 (GRCm39) Y66N possibly damaging Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Fry T C 5: 150,309,569 (GRCm39) L671P probably damaging Het
Galnt7 A G 8: 57,998,803 (GRCm39) I262T probably damaging Het
Glp1r T C 17: 31,150,221 (GRCm39) F381S probably benign Het
Gm3867 T C 9: 36,168,567 (GRCm39) noncoding transcript Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Gstm7 G A 3: 107,834,235 (GRCm39) T206I possibly damaging Het
H2bc7 A T 13: 23,758,231 (GRCm39) V45E possibly damaging Het
Hs3st5 A T 10: 36,704,802 (GRCm39) D35V probably benign Het
Hspa13 T C 16: 75,558,190 (GRCm39) H125R probably benign Het
Hspa1a T G 17: 35,190,156 (GRCm39) H249P probably damaging Het
Igkv10-95 A T 6: 68,657,562 (GRCm39) Q6L probably damaging Het
Il1rap T A 16: 26,533,526 (GRCm39) L474H probably benign Het
Ipo11 T A 13: 107,016,245 (GRCm39) Y489F probably benign Het
Itga5 A G 15: 103,259,259 (GRCm39) Y723H probably damaging Het
Itih2 T C 2: 10,109,971 (GRCm39) N594S probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Kif26b A G 1: 178,506,920 (GRCm39) Y332C probably damaging Het
Kmt2c G A 5: 25,559,382 (GRCm39) R1086W probably damaging Het
Ktn1 T A 14: 47,963,636 (GRCm39) probably benign Het
Lars2 T A 9: 123,247,758 (GRCm39) I305N probably damaging Het
Lgmn G T 12: 102,366,383 (GRCm39) probably benign Het
Ltbp4 C T 7: 27,006,125 (GRCm39) E1453K probably damaging Het
Lypd8 G A 11: 58,277,675 (GRCm39) M152I probably benign Het
Man2a1 T A 17: 65,019,454 (GRCm39) S773T probably benign Het
Map2k6 T G 11: 110,390,300 (GRCm39) L278R probably damaging Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mms19 A G 19: 41,933,935 (GRCm39) V811A possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl1 T A 17: 66,684,882 (GRCm39) H520L probably benign Het
Mymk A T 2: 26,952,719 (GRCm39) F130I probably damaging Het
Myo1f C T 17: 33,801,306 (GRCm39) R333C probably damaging Het
Myo9a T A 9: 59,779,165 (GRCm39) H1640Q probably benign Het
Nav1 A G 1: 135,520,186 (GRCm39) probably benign Het
Ncbp3 G T 11: 72,969,844 (GRCm39) G564C probably damaging Het
Ncoa4 A T 14: 31,898,682 (GRCm39) I501L probably benign Het
Ngp T A 9: 110,249,883 (GRCm39) N60K possibly damaging Het
Npc1l1 G T 11: 6,178,215 (GRCm39) D398E probably damaging Het
Nphs2 T A 1: 156,153,701 (GRCm39) M264K probably damaging Het
Or4s2b G A 2: 88,508,240 (GRCm39) V14I probably benign Het
Or4s2b T G 2: 88,508,523 (GRCm39) V101G probably benign Het
Or7e165 T A 9: 19,694,442 (GRCm39) Y4* probably null Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Patz1 A G 11: 3,256,241 (GRCm39) Y509C probably damaging Het
Pax8 G A 2: 24,311,595 (GRCm39) P447S probably damaging Het
Pde11a A G 2: 75,988,677 (GRCm39) V488A probably benign Het
Pex11g C T 8: 3,515,899 (GRCm39) V45M probably benign Het
Pik3ip1 T A 11: 3,283,327 (GRCm39) S142R probably damaging Het
Pitpnm2 C G 5: 124,263,434 (GRCm39) A819P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plin4 T A 17: 56,412,418 (GRCm39) M538L probably benign Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rev1 T C 1: 38,092,730 (GRCm39) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm39) probably benign Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Sgsm1 A T 5: 113,403,173 (GRCm39) F958Y probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorl1 C T 9: 41,943,210 (GRCm39) V889M possibly damaging Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Stam A T 2: 14,120,669 (GRCm39) H53L probably damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tarbp1 A G 8: 127,201,069 (GRCm39) Y246H probably damaging Het
Tbx15 A G 3: 99,259,683 (GRCm39) Y518C probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tescl T C 7: 24,032,683 (GRCm39) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tmem132d A G 5: 128,061,360 (GRCm39) V414A probably benign Het
Tmem41b T A 7: 109,573,941 (GRCm39) probably benign Het
Tnfrsf18 A G 4: 156,106,337 (GRCm39) probably benign Het
Tulp4 T A 17: 6,249,108 (GRCm39) D42E probably damaging Het
Ubtd1 A G 19: 42,022,103 (GRCm39) N125S probably damaging Het
Ubxn4 T A 1: 128,183,186 (GRCm39) F68I probably benign Het
Urb1 A G 16: 90,573,159 (GRCm39) S958P probably benign Het
Vash2 T C 1: 190,692,498 (GRCm39) S226G probably benign Het
Vmn2r120 C T 17: 57,816,120 (GRCm39) G745E probably damaging Het
Vmn2r58 T A 7: 41,487,117 (GRCm39) I593F probably benign Het
Zfp398 T C 6: 47,817,361 (GRCm39) L67P probably damaging Het
Zfp607b T A 7: 27,403,120 (GRCm39) H525Q probably damaging Het
Zfp629 T C 7: 127,211,492 (GRCm39) T106A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zic5 T A 14: 122,702,212 (GRCm39) D173V probably damaging Het
Zranb2 G A 3: 157,247,521 (GRCm39) probably benign Het
Other mutations in Gp1bb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Gp1bb APN 16 18,439,650 (GRCm39) missense possibly damaging 0.79
IGL02956:Gp1bb APN 16 18,439,675 (GRCm39) missense probably benign 0.06
R4603:Gp1bb UTSW 16 18,439,893 (GRCm39) missense probably damaging 1.00
R7007:Gp1bb UTSW 16 18,439,689 (GRCm39) missense possibly damaging 0.73
R8418:Gp1bb UTSW 16 18,440,103 (GRCm39) missense unknown
R9622:Gp1bb UTSW 16 18,439,527 (GRCm39) missense probably benign 0.22
R9702:Gp1bb UTSW 16 18,439,884 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACCTAGTAGAAGTGCCAATAG -3'
(R):5'- AGTGCTTCTCTTTCAGGGC -3'

Sequencing Primer
(F):5'- CAATAGCAGCGCGTGTAGC -3'
(R):5'- TCTTTCAGGGCCCCGTG -3'
Posted On 2015-09-25