Mutagenetix > Incidental Mutation

Incidental Mutation 'R4610:Il1rap'

344654

Institutional Source

Beutler Lab

Gene Symbol

Il1rap

Ensembl Gene

ENSMUSG00000022514

Gene Name

interleukin 1 receptor accessory protein

Synonyms

IL-1RAcP, 6430709H04Rik, IL-1R AcP

MMRRC Submission

041821-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4610 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26581704-26730117 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26714776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 474 (L474H)

Ref Sequence

ENSEMBL: ENSMUSP00000023156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023156] [ENSMUST00000096129] [ENSMUST00000166294] [ENSMUST00000174171]

AlphaFold

Q61730

Predicted Effect

probably benign
Transcript: ENSMUST00000023156
AA Change: L474H

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000023156
Gene: ENSMUSG00000022514
AA Change: L474H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IG	32	132	1.21e-2	SMART
IG	145	232	4.04e0	SMART
IG	251	350	1.46e-5	SMART
low complexity region	368	381	N/A	INTRINSIC
TIR	404	549	5.29e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000096129

SMART Domains

Protein: ENSMUSP00000093843
Gene: ENSMUSG00000022514

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IG	32	132	1.21e-2	SMART
IG	145	232	4.04e0	SMART
IG	251	350	1.46e-5	SMART
low complexity region	368	381	N/A	INTRINSIC
TIR	404	547	1.38e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166294

SMART Domains

Protein: ENSMUSP00000128100
Gene: ENSMUSG00000022514

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IG	32	132	1.21e-2	SMART
IG	145	232	4.04e0	SMART
IG	251	350	1.46e-5	SMART
low complexity region	368	381	N/A	INTRINSIC
TIR	404	547	1.38e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172522

Predicted Effect

probably benign
Transcript: ENSMUST00000174171

SMART Domains

Protein: ENSMUSP00000133904
Gene: ENSMUSG00000022514

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IG	32	132	1.21e-2	SMART
IG	145	232	4.04e0	SMART
Blast:IG	251	312	1e-28	BLAST
low complexity region	316	332	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174385

Meta Mutation Damage Score

0.1242

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (121/124)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal but show no biological response to IL-1. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,970,468	I69N	probably damaging	Het
Aars2	T	A	17: 45,516,921	D555E	probably damaging	Het
Adgre1	C	A	17: 57,450,073	Q777K	possibly damaging	Het
Agpat4	G	A	17: 12,210,377		probably null	Het
Ak7	G	A	12: 105,713,575	V123M	probably benign	Het
Ankle1	AT	A	8: 71,407,207		probably benign	Het
Ankrd44	T	G	1: 54,766,748		probably benign	Het
Aprt	A	T	8: 122,575,415		probably null	Het
Aptx	T	C	4: 40,702,766		probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
AY358078	T	A	14: 51,826,075	C393S	possibly damaging	Het
Bbip1	T	C	19: 53,932,175	M1V	probably null	Het
Cacng7	T	A	7: 3,336,691	M36K	probably benign	Het
Camta1	A	G	4: 151,084,827	W156R	probably damaging	Het
Casd1	G	A	6: 4,631,165		probably null	Het
Casz1	T	A	4: 148,933,267	Y338N	probably damaging	Het
Ccdc66	T	C	14: 27,500,420	N122S	probably damaging	Het
Celf2	G	T	2: 6,586,020	N279K	possibly damaging	Het
Cit	A	G	5: 115,994,087	T1801A	probably benign	Het
Cnot2	A	G	10: 116,499,418	I275T	probably damaging	Het
Ddx4	T	C	13: 112,612,060	K435E	probably damaging	Het
Dnajc6	T	C	4: 101,611,264	F166L	probably damaging	Het
Dst	T	C	1: 34,169,856	L820P	probably damaging	Het
Dusp11	T	A	6: 85,950,055	N193Y	probably damaging	Het
Eif3m	A	T	2: 105,013,288	N116K	probably benign	Het
Epb41l1	A	T	2: 156,509,261	E418D	possibly damaging	Het
Esyt2	T	G	12: 116,318,890	N153K	probably damaging	Het
Exoc6b	T	G	6: 85,003,159		probably benign	Het
Ezr	C	T	17: 6,739,722	E502K	possibly damaging	Het
Fbxw11	T	A	11: 32,711,859	Y66N	possibly damaging	Het
Frem2	A	G	3: 53,547,807	L2116S	possibly damaging	Het
Fry	T	C	5: 150,386,104	L671P	probably damaging	Het
Galnt7	A	G	8: 57,545,769	I262T	probably damaging	Het
Glp1r	T	C	17: 30,931,247	F381S	probably benign	Het
Gm3867	T	C	9: 36,257,271		noncoding transcript	Het
Gm5662	T	C	12: 88,271,774	N72S	probably benign	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Golgb1	A	G	16: 36,918,625	D2442G	probably damaging	Het
Gp1bb	A	T	16: 18,621,143	L67Q	probably damaging	Het
Gstm7	G	A	3: 107,926,919	T206I	possibly damaging	Het
Hist1h2bf	A	T	13: 23,574,057	V45E	possibly damaging	Het
Hs3st5	A	T	10: 36,828,806	D35V	probably benign	Het
Hspa13	T	C	16: 75,761,302	H125R	probably benign	Het
Hspa1a	T	G	17: 34,971,180	H249P	probably damaging	Het
Igkv10-95	A	T	6: 68,680,578	Q6L	probably damaging	Het
Ipo11	T	A	13: 106,879,737	Y489F	probably benign	Het
Itga5	A	G	15: 103,350,832	Y723H	probably damaging	Het
Itih2	T	C	2: 10,105,160	N594S	probably damaging	Het
Itk	T	A	11: 46,336,515	Q427L	probably benign	Het
Kif26b	A	G	1: 178,679,355	Y332C	probably damaging	Het
Kmt2c	G	A	5: 25,354,384	R1086W	probably damaging	Het
Ktn1	T	A	14: 47,726,179		probably benign	Het
Lars2	T	A	9: 123,418,693	I305N	probably damaging	Het
Lgmn	G	T	12: 102,400,124		probably benign	Het
Ltbp4	C	T	7: 27,306,700	E1453K	probably damaging	Het
Lypd8	G	A	11: 58,386,849	M152I	probably benign	Het
Man2a1	T	A	17: 64,712,459	S773T	probably benign	Het
Map2k6	T	G	11: 110,499,474	L278R	probably damaging	Het
Mbtps1	A	T	8: 119,535,347	D354E	probably damaging	Het
Mcpt9	C	T	14: 56,028,592	V60M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Mms19	A	G	19: 41,945,496	V811A	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mtcl1	T	A	17: 66,377,887	H520L	probably benign	Het
Mymk	A	T	2: 27,062,707	F130I	probably damaging	Het
Myo1f	C	T	17: 33,582,332	R333C	probably damaging	Het
Myo9a	T	A	9: 59,871,882	H1640Q	probably benign	Het
Nav1	A	G	1: 135,592,448		probably benign	Het
Ncbp3	G	T	11: 73,079,018	G564C	probably damaging	Het
Ncoa4	A	T	14: 32,176,725	I501L	probably benign	Het
Ngp	T	A	9: 110,420,815	N60K	possibly damaging	Het
Npc1l1	G	T	11: 6,228,215	D398E	probably damaging	Het
Nphs2	T	A	1: 156,326,131	M264K	probably damaging	Het
Olfr1193	G	A	2: 88,677,896	V14I	probably benign	Het
Olfr1193	T	G	2: 88,678,179	V101G	probably benign	Het
Olfr145	T	A	9: 37,898,326	S307R	probably benign	Het
Olfr58	T	A	9: 19,783,146	Y4*	probably null	Het
Patz1	A	G	11: 3,306,241	Y509C	probably damaging	Het
Pax8	G	A	2: 24,421,583	P447S	probably damaging	Het
Pde11a	A	G	2: 76,158,333	V488A	probably benign	Het
Pex11g	C	T	8: 3,465,899	V45M	probably benign	Het
Pik3ip1	T	A	11: 3,333,327	S142R	probably damaging	Het
Pitpnm2	C	G	5: 124,125,371	A819P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plin4	T	A	17: 56,105,418	M538L	probably benign	Het
Ppp3cb	T	C	14: 20,520,646	N339S	possibly damaging	Het
Rev1	T	C	1: 38,053,649	E1202G	probably damaging	Het
Rngtt	T	A	4: 33,339,133		probably benign	Het
Serpinb12	T	A	1: 106,949,153	D66E	probably benign	Het
Sgsm1	A	T	5: 113,255,307	F958Y	probably damaging	Het
Slc35e2	T	C	4: 155,617,649	F290S	probably benign	Het
Sorl1	C	T	9: 42,031,914	V889M	possibly damaging	Het
Sptlc3	G	A	2: 139,636,680	V520I	probably benign	Het
Stam	A	T	2: 14,115,858	H53L	probably damaging	Het
Stox2	A	G	8: 47,192,935	S497P	probably damaging	Het
Tarbp1	A	G	8: 126,474,330	Y246H	probably damaging	Het
Tbx15	A	G	3: 99,352,367	Y518C	probably damaging	Het
Tdrd5	T	A	1: 156,284,374	T479S	probably benign	Het
Tescl	T	C	7: 24,333,258	E214G	probably damaging	Het
Tex10	T	C	4: 48,452,946	D671G	probably benign	Het
Tmem132d	A	G	5: 127,984,296	V414A	probably benign	Het
Tmem41b	T	A	7: 109,974,734		probably benign	Het
Tnfrsf18	A	G	4: 156,021,880		probably benign	Het
Tulp4	T	A	17: 6,198,833	D42E	probably damaging	Het
Ubtd1	A	G	19: 42,033,664	N125S	probably damaging	Het
Ubxn4	T	A	1: 128,255,449	F68I	probably benign	Het
Urb1	A	G	16: 90,776,271	S958P	probably benign	Het
Vash2	T	C	1: 190,960,301	S226G	probably benign	Het
Vmn2r120	C	T	17: 57,509,120	G745E	probably damaging	Het
Vmn2r58	T	A	7: 41,837,693	I593F	probably benign	Het
Zfp398	T	C	6: 47,840,427	L67P	probably damaging	Het
Zfp607b	T	A	7: 27,703,695	H525Q	probably damaging	Het
Zfp629	T	C	7: 127,612,320	T106A	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zic5	T	A	14: 122,464,800	D173V	probably damaging	Het
Zranb2	G	A	3: 157,541,884		probably benign	Het

Other mutations in Il1rap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Il1rap	APN	16	26722401	missense	possibly damaging	0.77
IGL00976:Il1rap	APN	16	26698839	missense	probably benign	0.09
IGL01075:Il1rap	APN	16	26680237	missense	possibly damaging	0.94
IGL01665:Il1rap	APN	16	26722713	missense	probably damaging	1.00
IGL01962:Il1rap	APN	16	26710568	nonsense	probably null
IGL02101:Il1rap	APN	16	26624182	missense	possibly damaging	0.61
IGL02411:Il1rap	APN	16	26710616	missense	probably damaging	1.00
IGL03132:Il1rap	APN	16	26680119	missense	probably damaging	1.00
bacchus	UTSW	16	26710632	critical splice donor site	probably null
I1329:Il1rap	UTSW	16	26692850	missense	probably benign	0.07
LCD18:Il1rap	UTSW	16	26631593	intron	probably benign
PIT1430001:Il1rap	UTSW	16	26710593	missense	possibly damaging	0.53
R0302:Il1rap	UTSW	16	26692794	missense	probably benign	0.02
R0454:Il1rap	UTSW	16	26698875	missense	probably damaging	1.00
R0481:Il1rap	UTSW	16	26692835	missense	probably damaging	1.00
R0612:Il1rap	UTSW	16	26701105	missense	possibly damaging	0.48
R0765:Il1rap	UTSW	16	26710632	critical splice donor site	probably null
R1552:Il1rap	UTSW	16	26722434	missense	possibly damaging	0.79
R1801:Il1rap	UTSW	16	26698875	missense	probably damaging	1.00
R1867:Il1rap	UTSW	16	26722926	missense	probably damaging	1.00
R1942:Il1rap	UTSW	16	26722455	missense	probably damaging	1.00
R1996:Il1rap	UTSW	16	26722493	missense	probably benign	0.06
R2118:Il1rap	UTSW	16	26710565	missense	probably damaging	1.00
R2122:Il1rap	UTSW	16	26710565	missense	probably damaging	1.00
R2124:Il1rap	UTSW	16	26710565	missense	probably damaging	1.00
R3104:Il1rap	UTSW	16	26722752	missense	probably benign	0.01
R3105:Il1rap	UTSW	16	26722752	missense	probably benign	0.01
R3106:Il1rap	UTSW	16	26722752	missense	probably benign	0.01
R3891:Il1rap	UTSW	16	26676856	missense	probably damaging	1.00
R4133:Il1rap	UTSW	16	26722886	missense	probably benign	0.34
R4409:Il1rap	UTSW	16	26712265	splice site	probably null
R4755:Il1rap	UTSW	16	26722782	missense	probably benign	0.20
R4776:Il1rap	UTSW	16	26692799	missense	possibly damaging	0.57
R4793:Il1rap	UTSW	16	26695234	missense	probably benign	0.09
R4811:Il1rap	UTSW	16	26701238	critical splice donor site	probably null
R4834:Il1rap	UTSW	16	26676935	missense	probably damaging	1.00
R5119:Il1rap	UTSW	16	26624199	missense	probably benign	0.01
R5744:Il1rap	UTSW	16	26680224	missense	probably benign	0.01
R6108:Il1rap	UTSW	16	26722707	missense	probably damaging	1.00
R6149:Il1rap	UTSW	16	26712219	missense	probably damaging	1.00
R6233:Il1rap	UTSW	16	26710506	missense	probably benign	0.24
R6246:Il1rap	UTSW	16	26714881	missense	probably benign
R6249:Il1rap	UTSW	16	26692848	missense	possibly damaging	0.88
R6254:Il1rap	UTSW	16	26695270	missense	probably benign
R6748:Il1rap	UTSW	16	26722356	missense	probably benign	0.02
R7151:Il1rap	UTSW	16	26712128	missense	probably damaging	1.00
R7794:Il1rap	UTSW	16	26722908	missense	probably benign
R7818:Il1rap	UTSW	16	26698847	missense	probably damaging	1.00
R7819:Il1rap	UTSW	16	26722401	missense	possibly damaging	0.77
R7863:Il1rap	UTSW	16	26676711	missense	probably damaging	1.00
R8240:Il1rap	UTSW	16	26701251	missense	probably benign
R8559:Il1rap	UTSW	16	26712134	missense	probably benign	0.29
R8934:Il1rap	UTSW	16	26676984	missense	probably damaging	1.00
R8986:Il1rap	UTSW	16	26714946	missense	probably damaging	1.00
R9261:Il1rap	UTSW	16	26722974	missense	possibly damaging	0.83
R9286:Il1rap	UTSW	16	26698854	missense	possibly damaging	0.89
R9326:Il1rap	UTSW	16	26676891	missense	probably damaging	1.00
R9408:Il1rap	UTSW	16	26714925	missense	possibly damaging	0.91
R9493:Il1rap	UTSW	16	26722952	missense	probably benign	0.00
R9723:Il1rap	UTSW	16	26624157	start codon destroyed	probably null	0.97
X0027:Il1rap	UTSW	16	26701147	missense	probably benign	0.20
X0028:Il1rap	UTSW	16	26676964	missense	probably damaging	1.00
Z1176:Il1rap	UTSW	16	26722399	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCTGTCGTTCCAAGTTCC -3'
(R):5'- GACTCTTCTTCACTGGCATGGC -3'

Sequencing Primer
(F):5'- GCTGTCGTTCCAAGTTCCCTATC -3'
(R):5'- TGCAACTGCTTCCAGAACCTG -3'

Posted On

2015-09-25