Incidental Mutation 'R4610:Ezr'
ID 344659
Institutional Source Beutler Lab
Gene Symbol Ezr
Ensembl Gene ENSMUSG00000052397
Gene Name ezrin
Synonyms Vil2, cytovillin, ezrin, p81
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4610 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 7005530-7050179 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7007121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 502 (E502K)
Ref Sequence ENSEMBL: ENSMUSP00000063734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064234] [ENSMUST00000097430] [ENSMUST00000159394] [ENSMUST00000159880] [ENSMUST00000160483] [ENSMUST00000161118] [ENSMUST00000162635]
AlphaFold P26040
Predicted Effect possibly damaging
Transcript: ENSMUST00000064234
AA Change: E502K

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063734
Gene: ENSMUSG00000052397
AA Change: E502K

DomainStartEndE-ValueType
B41 1 206 7.74e-79 SMART
FERM_C 210 299 1.34e-35 SMART
Pfam:ERM 338 586 2.3e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097430
SMART Domains Protein: ENSMUSP00000095041
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 6e-25 PFAM
low complexity region 162 170 N/A INTRINSIC
C2 321 426 9.17e-15 SMART
C2 478 601 1.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131131
Predicted Effect probably benign
Transcript: ENSMUST00000159394
SMART Domains Protein: ENSMUSP00000124146
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 3.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159880
SMART Domains Protein: ENSMUSP00000125469
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
C2 116 221 9.17e-15 SMART
C2 273 396 1.92e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160483
SMART Domains Protein: ENSMUSP00000123996
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
C2 126 231 9.17e-15 SMART
C2 283 406 1.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231743
Predicted Effect probably benign
Transcript: ENSMUST00000162635
SMART Domains Protein: ENSMUSP00000124496
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 4.3e-27 PFAM
low complexity region 158 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232362
Meta Mutation Damage Score 0.1691 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic peripheral membrane protein encoded by this gene functions as a protein-tyrosine kinase substrate in microvilli. As a member of the ERM protein family, this protein serves as an intermediate between the plasma membrane and the actin cytoskeleton. This protein plays a key role in cell surface structure adhesion, migration and organization, and it has been implicated in various human cancers. A pseudogene located on chromosome 3 has been identified for this gene. Alternatively spliced variants have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality with abnormal intestinal villi morphology. Mice homozygous for a knock-down allele exhibit growth retardation, partial postnatal lethality, achlorhydria, and abnormal gastric parietal cell morphology and response to histamine stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Adgre1 C A 17: 57,757,073 (GRCm39) Q777K possibly damaging Het
Agpat4 G A 17: 12,429,264 (GRCm39) probably null Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Ankle1 AT A 8: 71,859,851 (GRCm39) probably benign Het
Ankrd44 T G 1: 54,805,907 (GRCm39) probably benign Het
Aprt A T 8: 123,302,154 (GRCm39) probably null Het
Aptx T C 4: 40,702,766 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Cacng7 T A 7: 3,385,207 (GRCm39) M36K probably benign Het
Camta1 A G 4: 151,169,284 (GRCm39) W156R probably damaging Het
Casd1 G A 6: 4,631,165 (GRCm39) probably null Het
Casz1 T A 4: 149,017,724 (GRCm39) Y338N probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cit A G 5: 116,132,146 (GRCm39) T1801A probably benign Het
Cnot2 A G 10: 116,335,323 (GRCm39) I275T probably damaging Het
Ddx4 T C 13: 112,748,594 (GRCm39) K435E probably damaging Het
Dnajc6 T C 4: 101,468,461 (GRCm39) F166L probably damaging Het
Dst T C 1: 34,208,937 (GRCm39) L820P probably damaging Het
Dusp11 T A 6: 85,927,037 (GRCm39) N193Y probably damaging Het
Eif1ad7 T C 12: 88,238,544 (GRCm39) N72S probably benign Het
Eif3m A T 2: 104,843,633 (GRCm39) N116K probably benign Het
Epb41l1 A T 2: 156,351,181 (GRCm39) E418D possibly damaging Het
Esyt2 T G 12: 116,282,510 (GRCm39) N153K probably damaging Het
Exoc6b T G 6: 84,980,141 (GRCm39) probably benign Het
Fbxw11 T A 11: 32,661,859 (GRCm39) Y66N possibly damaging Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Fry T C 5: 150,309,569 (GRCm39) L671P probably damaging Het
Galnt7 A G 8: 57,998,803 (GRCm39) I262T probably damaging Het
Glp1r T C 17: 31,150,221 (GRCm39) F381S probably benign Het
Gm3867 T C 9: 36,168,567 (GRCm39) noncoding transcript Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Gp1bb A T 16: 18,439,893 (GRCm39) L67Q probably damaging Het
Gstm7 G A 3: 107,834,235 (GRCm39) T206I possibly damaging Het
H2bc7 A T 13: 23,758,231 (GRCm39) V45E possibly damaging Het
Hs3st5 A T 10: 36,704,802 (GRCm39) D35V probably benign Het
Hspa13 T C 16: 75,558,190 (GRCm39) H125R probably benign Het
Hspa1a T G 17: 35,190,156 (GRCm39) H249P probably damaging Het
Igkv10-95 A T 6: 68,657,562 (GRCm39) Q6L probably damaging Het
Il1rap T A 16: 26,533,526 (GRCm39) L474H probably benign Het
Ipo11 T A 13: 107,016,245 (GRCm39) Y489F probably benign Het
Itga5 A G 15: 103,259,259 (GRCm39) Y723H probably damaging Het
Itih2 T C 2: 10,109,971 (GRCm39) N594S probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Kif26b A G 1: 178,506,920 (GRCm39) Y332C probably damaging Het
Kmt2c G A 5: 25,559,382 (GRCm39) R1086W probably damaging Het
Ktn1 T A 14: 47,963,636 (GRCm39) probably benign Het
Lars2 T A 9: 123,247,758 (GRCm39) I305N probably damaging Het
Lgmn G T 12: 102,366,383 (GRCm39) probably benign Het
Ltbp4 C T 7: 27,006,125 (GRCm39) E1453K probably damaging Het
Lypd8 G A 11: 58,277,675 (GRCm39) M152I probably benign Het
Man2a1 T A 17: 65,019,454 (GRCm39) S773T probably benign Het
Map2k6 T G 11: 110,390,300 (GRCm39) L278R probably damaging Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mms19 A G 19: 41,933,935 (GRCm39) V811A possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl1 T A 17: 66,684,882 (GRCm39) H520L probably benign Het
Mymk A T 2: 26,952,719 (GRCm39) F130I probably damaging Het
Myo1f C T 17: 33,801,306 (GRCm39) R333C probably damaging Het
Myo9a T A 9: 59,779,165 (GRCm39) H1640Q probably benign Het
Nav1 A G 1: 135,520,186 (GRCm39) probably benign Het
Ncbp3 G T 11: 72,969,844 (GRCm39) G564C probably damaging Het
Ncoa4 A T 14: 31,898,682 (GRCm39) I501L probably benign Het
Ngp T A 9: 110,249,883 (GRCm39) N60K possibly damaging Het
Npc1l1 G T 11: 6,178,215 (GRCm39) D398E probably damaging Het
Nphs2 T A 1: 156,153,701 (GRCm39) M264K probably damaging Het
Or4s2b G A 2: 88,508,240 (GRCm39) V14I probably benign Het
Or4s2b T G 2: 88,508,523 (GRCm39) V101G probably benign Het
Or7e165 T A 9: 19,694,442 (GRCm39) Y4* probably null Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Patz1 A G 11: 3,256,241 (GRCm39) Y509C probably damaging Het
Pax8 G A 2: 24,311,595 (GRCm39) P447S probably damaging Het
Pde11a A G 2: 75,988,677 (GRCm39) V488A probably benign Het
Pex11g C T 8: 3,515,899 (GRCm39) V45M probably benign Het
Pik3ip1 T A 11: 3,283,327 (GRCm39) S142R probably damaging Het
Pitpnm2 C G 5: 124,263,434 (GRCm39) A819P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plin4 T A 17: 56,412,418 (GRCm39) M538L probably benign Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rev1 T C 1: 38,092,730 (GRCm39) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm39) probably benign Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Sgsm1 A T 5: 113,403,173 (GRCm39) F958Y probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorl1 C T 9: 41,943,210 (GRCm39) V889M possibly damaging Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Stam A T 2: 14,120,669 (GRCm39) H53L probably damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tarbp1 A G 8: 127,201,069 (GRCm39) Y246H probably damaging Het
Tbx15 A G 3: 99,259,683 (GRCm39) Y518C probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tescl T C 7: 24,032,683 (GRCm39) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tmem132d A G 5: 128,061,360 (GRCm39) V414A probably benign Het
Tmem41b T A 7: 109,573,941 (GRCm39) probably benign Het
Tnfrsf18 A G 4: 156,106,337 (GRCm39) probably benign Het
Tulp4 T A 17: 6,249,108 (GRCm39) D42E probably damaging Het
Ubtd1 A G 19: 42,022,103 (GRCm39) N125S probably damaging Het
Ubxn4 T A 1: 128,183,186 (GRCm39) F68I probably benign Het
Urb1 A G 16: 90,573,159 (GRCm39) S958P probably benign Het
Vash2 T C 1: 190,692,498 (GRCm39) S226G probably benign Het
Vmn2r120 C T 17: 57,816,120 (GRCm39) G745E probably damaging Het
Vmn2r58 T A 7: 41,487,117 (GRCm39) I593F probably benign Het
Zfp398 T C 6: 47,817,361 (GRCm39) L67P probably damaging Het
Zfp607b T A 7: 27,403,120 (GRCm39) H525Q probably damaging Het
Zfp629 T C 7: 127,211,492 (GRCm39) T106A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zic5 T A 14: 122,702,212 (GRCm39) D173V probably damaging Het
Zranb2 G A 3: 157,247,521 (GRCm39) probably benign Het
Other mutations in Ezr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ezr APN 17 7,009,888 (GRCm39) unclassified probably benign
IGL02871:Ezr APN 17 7,009,789 (GRCm39) nonsense probably null
R0020:Ezr UTSW 17 7,010,126 (GRCm39) missense probably damaging 1.00
R0020:Ezr UTSW 17 7,010,126 (GRCm39) missense probably damaging 1.00
R0277:Ezr UTSW 17 7,022,164 (GRCm39) nonsense probably null
R0323:Ezr UTSW 17 7,022,164 (GRCm39) nonsense probably null
R0930:Ezr UTSW 17 7,021,398 (GRCm39) nonsense probably null
R1497:Ezr UTSW 17 7,010,107 (GRCm39) missense probably benign 0.07
R1669:Ezr UTSW 17 7,006,712 (GRCm39) missense probably damaging 1.00
R1801:Ezr UTSW 17 7,009,771 (GRCm39) missense possibly damaging 0.62
R2078:Ezr UTSW 17 7,050,041 (GRCm39) start codon destroyed probably null 0.23
R4250:Ezr UTSW 17 7,022,196 (GRCm39) missense probably damaging 1.00
R4448:Ezr UTSW 17 7,020,473 (GRCm39) missense probably benign 0.01
R4691:Ezr UTSW 17 7,026,961 (GRCm39) missense probably benign
R4736:Ezr UTSW 17 7,008,975 (GRCm39) missense probably benign 0.42
R5327:Ezr UTSW 17 7,020,448 (GRCm39) missense probably damaging 1.00
R6564:Ezr UTSW 17 7,010,246 (GRCm39) missense probably damaging 0.99
R7863:Ezr UTSW 17 7,008,863 (GRCm39) missense probably damaging 1.00
R8788:Ezr UTSW 17 7,021,392 (GRCm39) missense probably benign 0.29
R8910:Ezr UTSW 17 7,023,299 (GRCm39) missense probably damaging 1.00
R9712:Ezr UTSW 17 7,020,394 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCACTCCTTGTGGACTGAC -3'
(R):5'- TGTGTAAGGGTCCTCACTTGAC -3'

Sequencing Primer
(F):5'- ACTGACTGGGATATGCGGG -3'
(R):5'- TGACCAGCATTCTCCTCTCCAAAG -3'
Posted On 2015-09-25