Incidental Mutation 'R4610:Adgre1'
ID 344666
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Name adhesion G protein-coupled receptor E1
Synonyms DD7A5-7, EGF-TM7, Emr1, Ly71, F4/80, TM7LN3
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R4610 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 57665691-57790527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 57757073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 777 (Q777K)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
AlphaFold Q61549
Predicted Effect possibly damaging
Transcript: ENSMUST00000004850
AA Change: Q777K

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: Q777K

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086763
AA Change: Q777K

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: Q777K

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Meta Mutation Damage Score 0.3499 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Agpat4 G A 17: 12,429,264 (GRCm39) probably null Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Ankle1 AT A 8: 71,859,851 (GRCm39) probably benign Het
Ankrd44 T G 1: 54,805,907 (GRCm39) probably benign Het
Aprt A T 8: 123,302,154 (GRCm39) probably null Het
Aptx T C 4: 40,702,766 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Cacng7 T A 7: 3,385,207 (GRCm39) M36K probably benign Het
Camta1 A G 4: 151,169,284 (GRCm39) W156R probably damaging Het
Casd1 G A 6: 4,631,165 (GRCm39) probably null Het
Casz1 T A 4: 149,017,724 (GRCm39) Y338N probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cit A G 5: 116,132,146 (GRCm39) T1801A probably benign Het
Cnot2 A G 10: 116,335,323 (GRCm39) I275T probably damaging Het
Ddx4 T C 13: 112,748,594 (GRCm39) K435E probably damaging Het
Dnajc6 T C 4: 101,468,461 (GRCm39) F166L probably damaging Het
Dst T C 1: 34,208,937 (GRCm39) L820P probably damaging Het
Dusp11 T A 6: 85,927,037 (GRCm39) N193Y probably damaging Het
Eif1ad7 T C 12: 88,238,544 (GRCm39) N72S probably benign Het
Eif3m A T 2: 104,843,633 (GRCm39) N116K probably benign Het
Epb41l1 A T 2: 156,351,181 (GRCm39) E418D possibly damaging Het
Esyt2 T G 12: 116,282,510 (GRCm39) N153K probably damaging Het
Exoc6b T G 6: 84,980,141 (GRCm39) probably benign Het
Ezr C T 17: 7,007,121 (GRCm39) E502K possibly damaging Het
Fbxw11 T A 11: 32,661,859 (GRCm39) Y66N possibly damaging Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Fry T C 5: 150,309,569 (GRCm39) L671P probably damaging Het
Galnt7 A G 8: 57,998,803 (GRCm39) I262T probably damaging Het
Glp1r T C 17: 31,150,221 (GRCm39) F381S probably benign Het
Gm3867 T C 9: 36,168,567 (GRCm39) noncoding transcript Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Gp1bb A T 16: 18,439,893 (GRCm39) L67Q probably damaging Het
Gstm7 G A 3: 107,834,235 (GRCm39) T206I possibly damaging Het
H2bc7 A T 13: 23,758,231 (GRCm39) V45E possibly damaging Het
Hs3st5 A T 10: 36,704,802 (GRCm39) D35V probably benign Het
Hspa13 T C 16: 75,558,190 (GRCm39) H125R probably benign Het
Hspa1a T G 17: 35,190,156 (GRCm39) H249P probably damaging Het
Igkv10-95 A T 6: 68,657,562 (GRCm39) Q6L probably damaging Het
Il1rap T A 16: 26,533,526 (GRCm39) L474H probably benign Het
Ipo11 T A 13: 107,016,245 (GRCm39) Y489F probably benign Het
Itga5 A G 15: 103,259,259 (GRCm39) Y723H probably damaging Het
Itih2 T C 2: 10,109,971 (GRCm39) N594S probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Kif26b A G 1: 178,506,920 (GRCm39) Y332C probably damaging Het
Kmt2c G A 5: 25,559,382 (GRCm39) R1086W probably damaging Het
Ktn1 T A 14: 47,963,636 (GRCm39) probably benign Het
Lars2 T A 9: 123,247,758 (GRCm39) I305N probably damaging Het
Lgmn G T 12: 102,366,383 (GRCm39) probably benign Het
Ltbp4 C T 7: 27,006,125 (GRCm39) E1453K probably damaging Het
Lypd8 G A 11: 58,277,675 (GRCm39) M152I probably benign Het
Man2a1 T A 17: 65,019,454 (GRCm39) S773T probably benign Het
Map2k6 T G 11: 110,390,300 (GRCm39) L278R probably damaging Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mms19 A G 19: 41,933,935 (GRCm39) V811A possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl1 T A 17: 66,684,882 (GRCm39) H520L probably benign Het
Mymk A T 2: 26,952,719 (GRCm39) F130I probably damaging Het
Myo1f C T 17: 33,801,306 (GRCm39) R333C probably damaging Het
Myo9a T A 9: 59,779,165 (GRCm39) H1640Q probably benign Het
Nav1 A G 1: 135,520,186 (GRCm39) probably benign Het
Ncbp3 G T 11: 72,969,844 (GRCm39) G564C probably damaging Het
Ncoa4 A T 14: 31,898,682 (GRCm39) I501L probably benign Het
Ngp T A 9: 110,249,883 (GRCm39) N60K possibly damaging Het
Npc1l1 G T 11: 6,178,215 (GRCm39) D398E probably damaging Het
Nphs2 T A 1: 156,153,701 (GRCm39) M264K probably damaging Het
Or4s2b G A 2: 88,508,240 (GRCm39) V14I probably benign Het
Or4s2b T G 2: 88,508,523 (GRCm39) V101G probably benign Het
Or7e165 T A 9: 19,694,442 (GRCm39) Y4* probably null Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Patz1 A G 11: 3,256,241 (GRCm39) Y509C probably damaging Het
Pax8 G A 2: 24,311,595 (GRCm39) P447S probably damaging Het
Pde11a A G 2: 75,988,677 (GRCm39) V488A probably benign Het
Pex11g C T 8: 3,515,899 (GRCm39) V45M probably benign Het
Pik3ip1 T A 11: 3,283,327 (GRCm39) S142R probably damaging Het
Pitpnm2 C G 5: 124,263,434 (GRCm39) A819P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plin4 T A 17: 56,412,418 (GRCm39) M538L probably benign Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rev1 T C 1: 38,092,730 (GRCm39) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm39) probably benign Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Sgsm1 A T 5: 113,403,173 (GRCm39) F958Y probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorl1 C T 9: 41,943,210 (GRCm39) V889M possibly damaging Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Stam A T 2: 14,120,669 (GRCm39) H53L probably damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tarbp1 A G 8: 127,201,069 (GRCm39) Y246H probably damaging Het
Tbx15 A G 3: 99,259,683 (GRCm39) Y518C probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tescl T C 7: 24,032,683 (GRCm39) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tmem132d A G 5: 128,061,360 (GRCm39) V414A probably benign Het
Tmem41b T A 7: 109,573,941 (GRCm39) probably benign Het
Tnfrsf18 A G 4: 156,106,337 (GRCm39) probably benign Het
Tulp4 T A 17: 6,249,108 (GRCm39) D42E probably damaging Het
Ubtd1 A G 19: 42,022,103 (GRCm39) N125S probably damaging Het
Ubxn4 T A 1: 128,183,186 (GRCm39) F68I probably benign Het
Urb1 A G 16: 90,573,159 (GRCm39) S958P probably benign Het
Vash2 T C 1: 190,692,498 (GRCm39) S226G probably benign Het
Vmn2r120 C T 17: 57,816,120 (GRCm39) G745E probably damaging Het
Vmn2r58 T A 7: 41,487,117 (GRCm39) I593F probably benign Het
Zfp398 T C 6: 47,817,361 (GRCm39) L67P probably damaging Het
Zfp607b T A 7: 27,403,120 (GRCm39) H525Q probably damaging Het
Zfp629 T C 7: 127,211,492 (GRCm39) T106A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zic5 T A 14: 122,702,212 (GRCm39) D173V probably damaging Het
Zranb2 G A 3: 157,247,521 (GRCm39) probably benign Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57,757,055 (GRCm39) missense probably benign 0.00
IGL00966:Adgre1 APN 17 57,726,335 (GRCm39) missense probably benign 0.04
IGL01680:Adgre1 APN 17 57,709,620 (GRCm39) missense unknown
IGL01724:Adgre1 APN 17 57,751,064 (GRCm39) nonsense probably null
IGL02172:Adgre1 APN 17 57,785,879 (GRCm39) missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57,754,891 (GRCm39) missense probably benign 0.01
IGL02272:Adgre1 APN 17 57,757,021 (GRCm39) nonsense probably null
IGL02336:Adgre1 APN 17 57,718,024 (GRCm39) nonsense probably null
IGL02346:Adgre1 APN 17 57,750,919 (GRCm39) missense probably benign 0.15
IGL02398:Adgre1 APN 17 57,709,824 (GRCm39) nonsense probably null
IGL02618:Adgre1 APN 17 57,751,021 (GRCm39) missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57,787,921 (GRCm39) missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57,785,833 (GRCm39) missense probably benign 0.26
IGL03112:Adgre1 APN 17 57,755,029 (GRCm39) splice site probably null
IGL03350:Adgre1 APN 17 57,708,908 (GRCm39) missense probably benign 0.16
F480 UTSW 17 57,751,063 (GRCm39) missense probably damaging 1.00
lomax UTSW 17 57,709,811 (GRCm39) missense unknown
Onion UTSW 17 57,709,841 (GRCm39) nonsense probably null
Scallion UTSW 17 57,708,977 (GRCm39) missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57,709,841 (GRCm39) nonsense probably null
R0153:Adgre1 UTSW 17 57,750,939 (GRCm39) missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57,751,060 (GRCm39) missense probably benign 0.00
R0278:Adgre1 UTSW 17 57,754,872 (GRCm39) missense probably benign 0.07
R0323:Adgre1 UTSW 17 57,751,060 (GRCm39) missense probably benign 0.00
R0389:Adgre1 UTSW 17 57,713,839 (GRCm39) missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57,709,742 (GRCm39) missense unknown
R0621:Adgre1 UTSW 17 57,748,359 (GRCm39) missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57,718,003 (GRCm39) missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57,754,936 (GRCm39) missense probably benign 0.00
R1601:Adgre1 UTSW 17 57,748,353 (GRCm39) missense probably benign 0.01
R1689:Adgre1 UTSW 17 57,756,921 (GRCm39) missense probably benign 0.31
R1708:Adgre1 UTSW 17 57,708,974 (GRCm39) missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57,748,350 (GRCm39) missense probably benign 0.43
R1839:Adgre1 UTSW 17 57,748,299 (GRCm39) missense probably benign 0.00
R1860:Adgre1 UTSW 17 57,748,363 (GRCm39) missense probably benign 0.00
R2165:Adgre1 UTSW 17 57,726,338 (GRCm39) missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57,708,912 (GRCm39) missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57,717,956 (GRCm39) missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57,708,925 (GRCm39) missense probably benign 0.08
R3911:Adgre1 UTSW 17 57,754,860 (GRCm39) missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57,709,811 (GRCm39) missense unknown
R4439:Adgre1 UTSW 17 57,754,954 (GRCm39) missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57,717,947 (GRCm39) missense probably benign 0.34
R4529:Adgre1 UTSW 17 57,727,519 (GRCm39) missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57,713,874 (GRCm39) missense probably benign 0.07
R4665:Adgre1 UTSW 17 57,787,947 (GRCm39) missense probably benign 0.20
R4911:Adgre1 UTSW 17 57,754,832 (GRCm39) missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57,751,064 (GRCm39) nonsense probably null
R4942:Adgre1 UTSW 17 57,713,903 (GRCm39) missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57,750,918 (GRCm39) missense probably benign 0.33
R4953:Adgre1 UTSW 17 57,748,321 (GRCm39) missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57,708,977 (GRCm39) missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57,709,817 (GRCm39) missense probably benign 0.39
R5590:Adgre1 UTSW 17 57,752,034 (GRCm39) missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57,727,437 (GRCm39) missense probably benign 0.15
R5699:Adgre1 UTSW 17 57,788,007 (GRCm39) missense probably benign 0.43
R5734:Adgre1 UTSW 17 57,750,990 (GRCm39) missense probably benign 0.00
R5860:Adgre1 UTSW 17 57,752,034 (GRCm39) missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57,713,859 (GRCm39) missense probably benign 0.28
R6039:Adgre1 UTSW 17 57,713,859 (GRCm39) missense probably benign 0.28
R6149:Adgre1 UTSW 17 57,752,018 (GRCm39) missense probably benign 0.08
R6478:Adgre1 UTSW 17 57,708,955 (GRCm39) missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57,713,917 (GRCm39) missense probably benign 0.10
R6864:Adgre1 UTSW 17 57,785,879 (GRCm39) missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57,727,399 (GRCm39) missense probably benign 0.39
R6945:Adgre1 UTSW 17 57,717,844 (GRCm39) missense probably benign 0.01
R6988:Adgre1 UTSW 17 57,715,445 (GRCm39) missense probably benign 0.00
R7019:Adgre1 UTSW 17 57,717,945 (GRCm39) missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57,751,087 (GRCm39) splice site probably null
R7347:Adgre1 UTSW 17 57,727,441 (GRCm39) missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57,756,933 (GRCm39) missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57,709,519 (GRCm39) missense unknown
R7939:Adgre1 UTSW 17 57,756,938 (GRCm39) missense probably damaging 0.98
R7977:Adgre1 UTSW 17 57,754,987 (GRCm39) missense possibly damaging 0.54
R7987:Adgre1 UTSW 17 57,754,987 (GRCm39) missense possibly damaging 0.54
R8187:Adgre1 UTSW 17 57,727,349 (GRCm39) missense probably benign 0.00
R8210:Adgre1 UTSW 17 57,752,061 (GRCm39) missense possibly damaging 0.94
R8223:Adgre1 UTSW 17 57,668,692 (GRCm39) missense probably damaging 0.99
R8344:Adgre1 UTSW 17 57,715,459 (GRCm39) missense probably benign 0.12
R8698:Adgre1 UTSW 17 57,709,003 (GRCm39) missense probably benign 0.05
R9236:Adgre1 UTSW 17 57,709,782 (GRCm39) nonsense probably null
R9262:Adgre1 UTSW 17 57,754,941 (GRCm39) missense probably damaging 1.00
R9303:Adgre1 UTSW 17 57,748,275 (GRCm39) missense probably benign 0.00
R9305:Adgre1 UTSW 17 57,748,275 (GRCm39) missense probably benign 0.00
R9605:Adgre1 UTSW 17 57,718,083 (GRCm39) missense probably benign 0.00
R9661:Adgre1 UTSW 17 57,748,368 (GRCm39) missense possibly damaging 0.70
R9678:Adgre1 UTSW 17 57,750,997 (GRCm39) missense probably damaging 0.96
R9751:Adgre1 UTSW 17 57,757,101 (GRCm39) missense probably null 0.06
R9785:Adgre1 UTSW 17 57,785,930 (GRCm39) missense probably damaging 1.00
Z1176:Adgre1 UTSW 17 57,668,729 (GRCm39) missense possibly damaging 0.76
Z1177:Adgre1 UTSW 17 57,726,374 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCGGGATTCCTACACTATC -3'
(R):5'- CTTGGTGACATCACTGCTGG -3'

Sequencing Primer
(F):5'- GCGGGATTCCTACACTATCTTTTC -3'
(R):5'- AGGTCCTAGACTACTGTGGAC -3'
Posted On 2015-09-25