Incidental Mutation 'R4610:Mtcl1'
ID344669
Institutional Source Beutler Lab
Gene Symbol Mtcl1
Ensembl Gene ENSMUSG00000052105
Gene Namemicrotubule crosslinking factor 1
SynonymsSoga2, t8219b25, 1110012J17Rik
MMRRC Submission 041821-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R4610 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location66336982-66449750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66377887 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 520 (H520L)
Ref Sequence ENSEMBL: ENSMUSP00000121387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086693] [ENSMUST00000097291] [ENSMUST00000145347] [ENSMUST00000177034]
Predicted Effect probably benign
Transcript: ENSMUST00000086693
AA Change: H969L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083899
Gene: ENSMUSG00000052105
AA Change: H969L

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 493 587 1.8e-34 PFAM
Pfam:DUF3166 622 714 3.8e-39 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1344 3e-40 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
low complexity region 1912 1924 N/A INTRINSIC
low complexity region 1931 1943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097291
AA Change: H969L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094894
Gene: ENSMUSG00000052105
AA Change: H969L

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 492 588 1.8e-43 PFAM
Pfam:DUF3166 621 716 5e-19 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1392 3.9e-49 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144492
Predicted Effect probably benign
Transcript: ENSMUST00000145347
AA Change: H520L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121387
Gene: ENSMUSG00000052105
AA Change: H520L

DomainStartEndE-ValueType
Pfam:DUF3166 43 139 9.1e-44 PFAM
Pfam:DUF3166 172 267 2.5e-19 PFAM
low complexity region 394 410 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 600 613 N/A INTRINSIC
coiled coil region 671 710 N/A INTRINSIC
Pfam:DUF4482 771 910 4.6e-49 PFAM
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1223 1232 N/A INTRINSIC
low complexity region 1463 1475 N/A INTRINSIC
low complexity region 1482 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177034
AA Change: H617L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135690
Gene: ENSMUSG00000052105
AA Change: H617L

DomainStartEndE-ValueType
Pfam:DUF3166 140 236 1.5e-43 PFAM
Pfam:DUF3166 269 364 4e-19 PFAM
low complexity region 491 507 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
coiled coil region 642 674 N/A INTRINSIC
low complexity region 738 751 N/A INTRINSIC
coiled coil region 809 848 N/A INTRINSIC
Pfam:DUF4482 909 1042 4e-49 PFAM
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1369 1378 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype PHENOTYPE: Global or Purkinje cell-specific homozygous knockout affects Purkinje cell axon and dendrite morphology, resulting in abnormal motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Adgre1 C A 17: 57,450,073 Q777K possibly damaging Het
Agpat4 G A 17: 12,210,377 probably null Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankle1 AT A 8: 71,407,207 probably benign Het
Ankrd44 T G 1: 54,766,748 probably benign Het
Aprt A T 8: 122,575,415 probably null Het
Aptx T C 4: 40,702,766 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Cacng7 T A 7: 3,336,691 M36K probably benign Het
Camta1 A G 4: 151,084,827 W156R probably damaging Het
Casd1 G A 6: 4,631,165 probably null Het
Casz1 T A 4: 148,933,267 Y338N probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cit A G 5: 115,994,087 T1801A probably benign Het
Cnot2 A G 10: 116,499,418 I275T probably damaging Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dst T C 1: 34,169,856 L820P probably damaging Het
Dusp11 T A 6: 85,950,055 N193Y probably damaging Het
Eif3m A T 2: 105,013,288 N116K probably benign Het
Epb41l1 A T 2: 156,509,261 E418D possibly damaging Het
Esyt2 T G 12: 116,318,890 N153K probably damaging Het
Exoc6b T G 6: 85,003,159 probably benign Het
Ezr C T 17: 6,739,722 E502K possibly damaging Het
Fbxw11 T A 11: 32,711,859 Y66N possibly damaging Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Fry T C 5: 150,386,104 L671P probably damaging Het
Galnt7 A G 8: 57,545,769 I262T probably damaging Het
Glp1r T C 17: 30,931,247 F381S probably benign Het
Gm3867 T C 9: 36,257,271 noncoding transcript Het
Gm5662 T C 12: 88,271,774 N72S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gstm7 G A 3: 107,926,919 T206I possibly damaging Het
Hist1h2bf A T 13: 23,574,057 V45E possibly damaging Het
Hs3st5 A T 10: 36,828,806 D35V probably benign Het
Hspa13 T C 16: 75,761,302 H125R probably benign Het
Hspa1a T G 17: 34,971,180 H249P probably damaging Het
Igkv10-95 A T 6: 68,680,578 Q6L probably damaging Het
Il1rap T A 16: 26,714,776 L474H probably benign Het
Ipo11 T A 13: 106,879,737 Y489F probably benign Het
Itga5 A G 15: 103,350,832 Y723H probably damaging Het
Itih2 T C 2: 10,105,160 N594S probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Kif26b A G 1: 178,679,355 Y332C probably damaging Het
Kmt2c G A 5: 25,354,384 R1086W probably damaging Het
Ktn1 T A 14: 47,726,179 probably benign Het
Lars2 T A 9: 123,418,693 I305N probably damaging Het
Lgmn G T 12: 102,400,124 probably benign Het
Ltbp4 C T 7: 27,306,700 E1453K probably damaging Het
Lypd8 G A 11: 58,386,849 M152I probably benign Het
Man2a1 T A 17: 64,712,459 S773T probably benign Het
Map2k6 T G 11: 110,499,474 L278R probably damaging Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mms19 A G 19: 41,945,496 V811A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mymk A T 2: 27,062,707 F130I probably damaging Het
Myo1f C T 17: 33,582,332 R333C probably damaging Het
Myo9a T A 9: 59,871,882 H1640Q probably benign Het
Nav1 A G 1: 135,592,448 probably benign Het
Ncbp3 G T 11: 73,079,018 G564C probably damaging Het
Ncoa4 A T 14: 32,176,725 I501L probably benign Het
Ngp T A 9: 110,420,815 N60K possibly damaging Het
Npc1l1 G T 11: 6,228,215 D398E probably damaging Het
Nphs2 T A 1: 156,326,131 M264K probably damaging Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr58 T A 9: 19,783,146 Y4* probably null Het
Patz1 A G 11: 3,306,241 Y509C probably damaging Het
Pax8 G A 2: 24,421,583 P447S probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Pex11g C T 8: 3,465,899 V45M probably benign Het
Pik3ip1 T A 11: 3,333,327 S142R probably damaging Het
Pitpnm2 C G 5: 124,125,371 A819P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plin4 T A 17: 56,105,418 M538L probably benign Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rev1 T C 1: 38,053,649 E1202G probably damaging Het
Rngtt T A 4: 33,339,133 probably benign Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgsm1 A T 5: 113,255,307 F958Y probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorl1 C T 9: 42,031,914 V889M possibly damaging Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stam A T 2: 14,115,858 H53L probably damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tarbp1 A G 8: 126,474,330 Y246H probably damaging Het
Tbx15 A G 3: 99,352,367 Y518C probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tescl T C 7: 24,333,258 E214G probably damaging Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tmem132d A G 5: 127,984,296 V414A probably benign Het
Tmem41b T A 7: 109,974,734 probably benign Het
Tnfrsf18 A G 4: 156,021,880 probably benign Het
Tulp4 T A 17: 6,198,833 D42E probably damaging Het
Ubtd1 A G 19: 42,033,664 N125S probably damaging Het
Ubxn4 T A 1: 128,255,449 F68I probably benign Het
Urb1 A G 16: 90,776,271 S958P probably benign Het
Vash2 T C 1: 190,960,301 S226G probably benign Het
Vmn2r120 C T 17: 57,509,120 G745E probably damaging Het
Vmn2r58 T A 7: 41,837,693 I593F probably benign Het
Zfp398 T C 6: 47,840,427 L67P probably damaging Het
Zfp607b T A 7: 27,703,695 H525Q probably damaging Het
Zfp629 T C 7: 127,612,320 T106A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zic5 T A 14: 122,464,800 D173V probably damaging Het
Zranb2 G A 3: 157,541,884 probably benign Het
Other mutations in Mtcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Mtcl1 APN 17 66344319 missense probably benign 0.00
IGL01774:Mtcl1 APN 17 66385885 missense probably damaging 1.00
IGL01918:Mtcl1 APN 17 66368268 missense possibly damaging 0.47
IGL02000:Mtcl1 APN 17 66354190 missense probably benign 0.19
IGL02074:Mtcl1 APN 17 66366468 missense possibly damaging 0.68
IGL02338:Mtcl1 APN 17 66379970 missense probably damaging 1.00
IGL02597:Mtcl1 APN 17 66338021 missense probably benign
IGL03034:Mtcl1 APN 17 66344198 missense probably damaging 1.00
IGL03120:Mtcl1 APN 17 66379383 missense probably damaging 0.96
IGL03184:Mtcl1 APN 17 66354214 missense probably benign 0.01
IGL03240:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03294:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03332:Mtcl1 APN 17 66338019 missense probably damaging 1.00
PIT4378001:Mtcl1 UTSW 17 66438279 missense probably damaging 1.00
PIT4520001:Mtcl1 UTSW 17 66385912 missense possibly damaging 0.48
R0110:Mtcl1 UTSW 17 66358114 missense possibly damaging 0.51
R0113:Mtcl1 UTSW 17 66354242 missense possibly damaging 0.52
R0321:Mtcl1 UTSW 17 66379431 missense probably damaging 1.00
R0366:Mtcl1 UTSW 17 66338129 missense probably damaging 1.00
R0629:Mtcl1 UTSW 17 66338142 missense possibly damaging 0.89
R1466:Mtcl1 UTSW 17 66380435 missense probably damaging 1.00
R1467:Mtcl1 UTSW 17 66448327 missense probably damaging 1.00
R1471:Mtcl1 UTSW 17 66379148 missense probably damaging 0.96
R1650:Mtcl1 UTSW 17 66385876 missense probably damaging 1.00
R1754:Mtcl1 UTSW 17 66380183 missense probably damaging 1.00
R1855:Mtcl1 UTSW 17 66379514 missense probably benign
R1882:Mtcl1 UTSW 17 66379320 missense probably benign 0.01
R1935:Mtcl1 UTSW 17 66379414 missense probably benign 0.10
R2063:Mtcl1 UTSW 17 66346355 missense probably damaging 1.00
R2132:Mtcl1 UTSW 17 66343623 missense probably benign 0.04
R2197:Mtcl1 UTSW 17 66366432 missense probably benign
R3196:Mtcl1 UTSW 17 66343834 missense probably benign 0.07
R3877:Mtcl1 UTSW 17 66342954 missense probably damaging 1.00
R4116:Mtcl1 UTSW 17 66366481 missense probably benign
R4204:Mtcl1 UTSW 17 66438261 missense probably damaging 1.00
R4373:Mtcl1 UTSW 17 66380079 missense probably benign 0.05
R4396:Mtcl1 UTSW 17 66344225 missense probably damaging 1.00
R4591:Mtcl1 UTSW 17 66348511 missense probably benign 0.07
R4681:Mtcl1 UTSW 17 66449144 missense unknown
R4922:Mtcl1 UTSW 17 66348479 missense probably benign 0.29
R4992:Mtcl1 UTSW 17 66342839 missense probably damaging 0.99
R5169:Mtcl1 UTSW 17 66343823 missense probably benign 0.00
R5542:Mtcl1 UTSW 17 66384359 intron probably benign
R5804:Mtcl1 UTSW 17 66343137 missense probably benign 0.03
R5998:Mtcl1 UTSW 17 66368280 missense probably damaging 0.99
R6163:Mtcl1 UTSW 17 66379331 missense probably benign 0.10
R6191:Mtcl1 UTSW 17 66343526 missense probably damaging 1.00
R6254:Mtcl1 UTSW 17 66358134 missense probably benign 0.02
R6260:Mtcl1 UTSW 17 66343541 missense probably damaging 1.00
R6524:Mtcl1 UTSW 17 66348285 missense probably benign 0.15
R6884:Mtcl1 UTSW 17 66438202 missense probably damaging 1.00
R7199:Mtcl1 UTSW 17 66340539 missense probably benign 0.13
R7431:Mtcl1 UTSW 17 66342906 nonsense probably null
R7479:Mtcl1 UTSW 17 66379490 missense probably benign
R7564:Mtcl1 UTSW 17 66371327 missense probably benign
R7608:Mtcl1 UTSW 17 66343305 missense probably damaging 0.96
R7691:Mtcl1 UTSW 17 66380357 missense probably damaging 1.00
X0065:Mtcl1 UTSW 17 66379607 missense probably damaging 1.00
Z1088:Mtcl1 UTSW 17 66343728 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CTGTCCAAAGATTGTACTGGGGA -3'
(R):5'- CACGCTCTTCTCTGTCTGATAG -3'

Sequencing Primer
(F):5'- CTCCACAAGTAGATGGTGATTCTGC -3'
(R):5'- GATAGTTCTTCCCATTGTCTACCCAC -3'
Posted On2015-09-25