Incidental Mutation 'R4611:Trank1'
ID344735
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission 041822-MU
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4611 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111362261 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 446 (I446N)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably damaging
Transcript: ENSMUST00000078626
AA Change: I446N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: I446N

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200151
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,393 R200C probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Apc T C 18: 34,318,565 L2804P probably damaging Het
Apob C A 12: 8,011,331 A3271E probably damaging Het
Asl G T 5: 130,018,316 A147E probably damaging Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bcl11b T C 12: 107,916,530 K509E probably damaging Het
Btnl1 T C 17: 34,379,725 I105T probably damaging Het
Btnl10 A G 11: 58,920,357 T169A probably damaging Het
C8b T C 4: 104,790,644 I278T probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd8b1 T C 6: 71,332,475 V181A probably benign Het
Cdan1 A T 2: 120,730,720 V189D probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cfap52 T C 11: 67,926,421 N549D probably damaging Het
Cmklr1 C T 5: 113,614,869 V24M probably benign Het
Cntnap4 G T 8: 112,773,739 probably null Het
Col27a1 G A 4: 63,293,506 G91R probably damaging Het
Col5a3 A G 9: 20,814,896 probably benign Het
Dcc C T 18: 71,548,998 probably null Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah8 T A 17: 30,684,237 L950H probably damaging Het
Dnajc7 A T 11: 100,590,977 Y228* probably null Het
Doxl2 A T 6: 48,975,156 Q5L probably benign Het
Eno1b T C 18: 48,047,703 V316A probably damaging Het
Exoc4 T C 6: 33,438,405 M404T possibly damaging Het
Fignl1 A T 11: 11,801,268 C596S probably benign Het
Fn1 A C 1: 71,624,178 Y1050* probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gba2 T A 4: 43,568,092 S732C probably damaging Het
Gcnt4 C A 13: 96,946,482 S95R probably benign Het
Gpr37 A G 6: 25,669,624 V407A probably benign Het
Gria2 A T 3: 80,692,492 M695K probably damaging Het
Hoxa9 T C 6: 52,225,710 K132R probably damaging Het
Ifi213 T A 1: 173,589,914 T311S possibly damaging Het
Itgb2 T A 10: 77,550,050 N282K probably damaging Het
Kcnh8 A T 17: 52,602,836 Q11L probably benign Het
Klk14 T C 7: 43,694,357 C163R probably damaging Het
Klk1b3 T A 7: 44,201,265 W74R possibly damaging Het
Krtap13-1 G T 16: 88,729,254 C122F possibly damaging Het
Luzp2 T C 7: 55,063,356 probably null Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtor T A 4: 148,486,119 V1211E probably benign Het
Myb T A 10: 21,145,324 D402V probably damaging Het
Ncor2 G A 5: 125,030,859 T1593I probably damaging Het
Ndst3 A G 3: 123,671,549 I258T probably benign Het
Npy6r C A 18: 44,276,401 H296Q probably damaging Het
Olfml2b T A 1: 170,644,947 L9H probably damaging Het
Olfr1364 A T 13: 21,573,574 V294D probably damaging Het
Olfr1442 T A 19: 12,674,954 Y250N probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr1475 C T 19: 13,480,012 C62Y probably damaging Het
Olfr43 A T 11: 74,206,535 V227D possibly damaging Het
Olfr519 A G 7: 108,894,117 C97R probably damaging Het
Olfr727 C A 14: 50,127,073 N165K probably benign Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parg G A 14: 32,274,864 R304Q probably damaging Het
Pdf T G 8: 107,048,535 S22R probably benign Het
Phlpp2 A T 8: 109,876,883 R60S possibly damaging Het
Piwil2 C T 14: 70,402,197 E401K probably benign Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Polr3a T C 14: 24,452,508 probably null Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ptch2 G A 4: 117,110,378 D748N probably benign Het
Rai14 A C 15: 10,592,138 Y224D probably damaging Het
Rft1 A G 14: 30,689,790 I432V probably damaging Het
Rictor C T 15: 6,787,144 A1299V possibly damaging Het
Sall2 A G 14: 52,313,753 C662R probably damaging Het
Scn4b A G 9: 45,150,439 N208D probably damaging Het
Sdhb G A 4: 140,972,915 G109R probably damaging Het
Sec16a A G 2: 26,441,805 V66A probably benign Het
Sema4g A G 19: 45,001,612 Y710C probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Shc4 T A 2: 125,655,682 D369V probably benign Het
Siglech T C 7: 55,771,693 L285P probably damaging Het
Skint6 A G 4: 113,074,076 M506T probably benign Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Slfn14 T A 11: 83,283,314 K284* probably null Het
Sox14 A G 9: 99,875,662 I8T probably damaging Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Tdpoz3 A T 3: 93,827,023 H335L probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tnik T C 3: 28,542,100 probably null Het
Tnpo2 T C 8: 85,053,803 S720P probably benign Het
Tpst1 A G 5: 130,101,706 K6E probably damaging Het
Trmt44 A T 5: 35,575,007 D13E probably benign Het
Ubr4 T A 4: 139,399,579 V471E possibly damaging Het
Ubtd1 A G 19: 42,033,591 T101A probably benign Het
Ugt3a1 A T 15: 9,306,400 K212* probably null Het
Zbtb7c C T 18: 76,136,847 A2V possibly damaging Het
Zfp423 C T 8: 87,688,081 G1182D possibly damaging Het
Zfp618 G A 4: 63,132,979 V666M probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Zscan20 T C 4: 128,588,106 T588A probably benign Het
Zscan25 G A 5: 145,291,116 R530H probably damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111390107 missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111347912 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
R7127:Trank1 UTSW 9 111365796 missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111345515 critical splice donor site probably null
R7236:Trank1 UTSW 9 111373074 missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111367512 missense probably damaging 1.00
R7292:Trank1 UTSW 9 111377870 missense probably benign 0.02
R7310:Trank1 UTSW 9 111367126 missense probably damaging 1.00
R7431:Trank1 UTSW 9 111362402 missense probably benign 0.12
R7448:Trank1 UTSW 9 111366349 missense probably benign 0.01
R7477:Trank1 UTSW 9 111364957 missense probably benign 0.00
R7514:Trank1 UTSW 9 111364756 missense probably damaging 1.00
R7595:Trank1 UTSW 9 111365991 missense probably damaging 1.00
R7637:Trank1 UTSW 9 111365296 missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111391685 missense probably benign
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGAGCTCCTTAGTCAGTGCC -3'
(R):5'- AGTACAGATGTCCAGGTCCG -3'

Sequencing Primer
(F):5'- CATGGCTAAGTAACTTGTCCAAAG -3'
(R):5'- CGAGAGGTCACAATCCTTGATGAC -3'
Posted On2015-09-25