Mutagenetix > Incidental Mutation

Incidental Mutation 'R4612:Mre11a'

344841

Institutional Source

Beutler Lab

Gene Symbol

Mre11a

Ensembl Gene

ENSMUSG00000031928

Gene Name

MRE11A homolog A, double strand break repair nuclease

Synonyms

MMRRC Submission

041823-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4612 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14784654-14837123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14802903 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 267 (G267R)

Ref Sequence

ENSEMBL: ENSMUSP00000111295 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632] [ENSMUST00000147305]

AlphaFold

Q61216

Predicted Effect

probably damaging
Transcript: ENSMUST00000034405
AA Change: G267R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: G267R

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	6.3e-15	PFAM
Mre11_DNA_bind	294	462	1.72e-70	SMART
coiled coil region	487	519	N/A	INTRINSIC
low complexity region	566	594	N/A	INTRINSIC
low complexity region	683	699	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115632
AA Change: G267R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: G267R

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	1.1e-31	PFAM
Mre11_DNA_bind	294	435	7.6e-49	SMART
coiled coil region	460	492	N/A	INTRINSIC
low complexity region	539	567	N/A	INTRINSIC
low complexity region	656	672	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136568

SMART Domains

Protein: ENSMUSP00000121012
Gene: ENSMUSG00000031928

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	1	107	1e-70	PDB
SCOP:d1ii7a_	3	107	7e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147305

SMART Domains

Protein: ENSMUSP00000116321
Gene: ENSMUSG00000031928

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	199	1.2e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147676

SMART Domains

Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	2	50	3e-26	PDB
Mre11_DNA_bind	62	170	1.81e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216810

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019D03Rik	T	C	1: 52,925,476	D31G	probably benign	Het
5730455P16Rik	A	T	11: 80,377,980	M1K	probably null	Het
Abca15	A	G	7: 120,335,161	D120G	probably benign	Het
Adam26a	A	T	8: 43,568,793	N553K	probably damaging	Het
Adam32	A	T	8: 24,872,736	C558S	probably damaging	Het
Adam39	A	T	8: 40,825,921	S450C	probably damaging	Het
Agap2	A	T	10: 127,080,096	T159S	unknown	Het
Ahnak	G	A	19: 9,003,724	V791I	probably benign	Het
Ak7	T	G	12: 105,761,513	L468R	probably damaging	Het
Akap12	A	G	10: 4,354,456	D422G	probably damaging	Het
Antxr1	T	A	6: 87,288,173	I129F	probably damaging	Het
Arhgap32	G	A	9: 32,259,479	G1185D	probably damaging	Het
Atf7ip2	A	T	16: 10,241,563	E322D	probably benign	Het
Atg4b	T	C	1: 93,786,541	F349L	probably damaging	Het
Atp6v1c1	A	G	15: 38,677,612	K127R	probably damaging	Het
Atxn1l	C	T	8: 109,732,104	V509M	possibly damaging	Het
B3glct	T	A	5: 149,739,557	I260N	probably damaging	Het
Bcl2l12	G	A	7: 44,996,585	P70L	probably damaging	Het
Bok	T	A	1: 93,694,178	F157L	probably damaging	Het
Bves	G	A	10: 45,339,277	G16D	probably benign	Het
Cacna1b	T	A	2: 24,626,852	K65*	probably null	Het
Casc3	A	G	11: 98,822,958	T339A	probably benign	Het
Ccdc18	C	T	5: 108,135,441	S6L	probably benign	Het
Cd86	A	G	16: 36,615,330	Y242H	probably benign	Het
Chd3	A	C	11: 69,353,209	Y1249*	probably null	Het
Chrne	T	C	11: 70,617,022	T284A	probably damaging	Het
Col12a1	T	C	9: 79,616,057	D2746G	probably damaging	Het
Cryaa	T	A	17: 31,678,474	M72K	probably benign	Het
Csmd1	G	T	8: 15,921,908		probably null	Het
Det1	A	T	7: 78,843,706	N183K	probably damaging	Het
Dis3	C	A	14: 99,091,435	V294L	probably benign	Het
Dnah2	G	A	11: 69,483,367	L1493F	possibly damaging	Het
Dsc2	A	T	18: 20,041,819	D466E	probably damaging	Het
Dsg4	T	A	18: 20,462,413	S558T	probably benign	Het
Dzip3	A	T	16: 48,952,040	L422*	probably null	Het
Elp6	T	C	9: 110,314,019	F100S	probably damaging	Het
Epg5	C	T	18: 77,982,414	T1224I	possibly damaging	Het
F830016B08Rik	T	A	18: 60,301,015	I390N	probably benign	Het
Fam110c	A	G	12: 31,074,656	T206A	unknown	Het
Fam160a1	G	A	3: 85,730,372	R207*	probably null	Het
Fam187b	G	A	7: 30,977,093	G9D	possibly damaging	Het
Fat1	A	G	8: 45,025,147	D2410G	probably damaging	Het
Fbln1	T	A	15: 85,238,559	F390Y	probably benign	Het
Fgg	A	G	3: 83,010,090	N142S	probably damaging	Het
Flcn	T	C	11: 59,792,687	T555A	probably damaging	Het
Foxq1	G	T	13: 31,558,825		probably benign	Het
Gm3233	A	T	10: 77,759,664		probably benign	Het
Gm5346	A	T	8: 43,626,550	F212L	probably benign	Het
Gm7271	A	T	5: 76,516,498	N145Y	probably damaging	Het
Gprc5a	G	A	6: 135,078,929	V125I	probably damaging	Het
Gria2	T	C	3: 80,732,051	D218G	probably damaging	Het
Gtf3c5	C	T	2: 28,579,584	A103T	probably benign	Het
Hspg2	A	G	4: 137,539,575	T1964A	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Htatip2	G	T	7: 49,772,597	E188*	probably null	Het
Ifna13	T	G	4: 88,643,876	E170D	probably damaging	Het
Il4ra	A	G	7: 125,576,083	T488A	probably benign	Het
Jup	G	T	11: 100,381,834	H251N	probably damaging	Het
Kif21a	A	T	15: 90,968,223		probably null	Het
Klhl28	T	A	12: 64,957,260	I160L	probably damaging	Het
Klk5	A	T	7: 43,845,272	T60S	possibly damaging	Het
Kntc1	A	G	5: 123,812,643	R1995G	probably damaging	Het
Lrig2	A	C	3: 104,462,783	I844M	probably damaging	Het
Lrp2	C	T	2: 69,458,427	W3698*	probably null	Het
Lyar	T	A	5: 38,224,709	S12T	possibly damaging	Het
Map3k19	T	C	1: 127,815,300	K1507E	probably benign	Het
Mthfd1l	A	G	10: 4,030,717	Q473R	probably damaging	Het
Ncald	T	A	15: 37,397,349	E29V	probably benign	Het
Neb	T	C	2: 52,287,243	D1362G	probably damaging	Het
Nme2	T	C	11: 93,955,602	T7A	possibly damaging	Het
Nod2	T	A	8: 88,665,036	L657Q	possibly damaging	Het
Nrm	T	A	17: 35,863,529	V75E	probably benign	Het
Ogfod1	A	C	8: 94,037,347	K20T	possibly damaging	Het
Olfr197	T	C	16: 59,186,311	I57M	probably damaging	Het
Olfr294	T	A	7: 86,615,736	Q303L	probably benign	Het
Olfr63	T	A	17: 33,269,480	V252E	probably benign	Het
Omp	T	C	7: 98,145,141	N93S	probably damaging	Het
Pcdhb15	A	C	18: 37,475,595	T627P	probably damaging	Het
Pld1	A	G	3: 28,131,733	T1036A	possibly damaging	Het
Pogk	C	A	1: 166,398,765	E606*	probably null	Het
Ppp1r10	T	A	17: 35,927,931	L292Q	probably damaging	Het
Prpf6	T	C	2: 181,632,079	C339R	possibly damaging	Het
Psd	T	A	19: 46,313,339	D937V	probably benign	Het
Rbak	T	C	5: 143,174,467	Q277R	probably benign	Het
Sbno1	T	A	5: 124,404,024	Y355F	probably damaging	Het
Sec23ip	C	T	7: 128,750,502	Q201*	probably null	Het
Serpinb3a	T	C	1: 107,047,607	K157E	probably damaging	Het
Slc22a28	A	T	19: 8,101,406	N306K	probably damaging	Het
Smarca2	C	A	19: 26,776,225	D1584E	possibly damaging	Het
Snx29	C	A	16: 11,447,495	Q530K	probably damaging	Het
Stard10	C	A	7: 101,345,670	Q278K	possibly damaging	Het
Tgm2	C	T	2: 158,124,204	C510Y	probably benign	Het
Tlr9	C	T	9: 106,223,807	P99L	probably damaging	Het
Tmco4	T	C	4: 138,990,560	W4R	probably benign	Het
Tmem151a	T	A	19: 5,071,834		probably benign	Het
Tmem255b	T	C	8: 13,454,228	V140A	probably benign	Het
Trbj1-2	C	T	6: 41,534,016		probably benign	Het
Trpm2	T	C	10: 77,945,916	T290A	probably damaging	Het
Tsc22d1	G	A	14: 76,419,005	E120K	possibly damaging	Het
Ttc29	A	G	8: 78,325,546	D352G	probably benign	Het
Usp25	A	T	16: 77,033,945	I30F	possibly damaging	Het
Usp34	A	C	11: 23,432,268	N1993T	probably damaging	Het
Vmn2r124	A	C	17: 18,063,022	H326P	probably benign	Het
Vmn2r92	C	A	17: 18,166,870	T157K	probably benign	Het
Vstm5	A	T	9: 15,257,493	I118F	probably benign	Het
Vwa7	T	C	17: 35,023,450	V510A	probably damaging	Het
Zfhx4	G	A	3: 5,397,063	S1266N	probably damaging	Het
Zfp763	T	A	17: 33,018,948	N408Y	probably benign	Het
Zswim5	C	T	4: 116,986,704	H980Y	probably damaging	Het

Other mutations in Mre11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Mre11a	APN	9	14825208	missense	probably benign	0.28
IGL00429:Mre11a	APN	9	14802813	missense	probably damaging	1.00
IGL00922:Mre11a	APN	9	14799588	missense	probably damaging	1.00
IGL01095:Mre11a	APN	9	14809824	missense	probably benign
IGL01294:Mre11a	APN	9	14830915	missense	probably damaging	0.97
IGL01871:Mre11a	APN	9	14811897	missense	possibly damaging	0.95
IGL02194:Mre11a	APN	9	14815209	missense	possibly damaging	0.70
IGL02213:Mre11a	APN	9	14811884	missense	probably damaging	1.00
IGL02245:Mre11a	APN	9	14815276	unclassified	probably benign
IGL02749:Mre11a	APN	9	14826591	missense	possibly damaging	0.78
IGL02812:Mre11a	APN	9	14790670	splice site	probably null
bow	UTSW	9	14786962	missense	probably damaging	1.00
R0050:Mre11a	UTSW	9	14830973	splice site	probably benign
R0594:Mre11a	UTSW	9	14815209	missense	probably benign	0.00
R1241:Mre11a	UTSW	9	14799639	missense	probably damaging	1.00
R1905:Mre11a	UTSW	9	14799627	missense	probably benign	0.08
R2030:Mre11a	UTSW	9	14795805	missense	probably damaging	1.00
R2270:Mre11a	UTSW	9	14815174	missense	probably benign	0.00
R2511:Mre11a	UTSW	9	14795769	critical splice acceptor site	probably null
R2851:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2852:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2853:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R3765:Mre11a	UTSW	9	14809847	missense	probably benign	0.25
R5007:Mre11a	UTSW	9	14809820	missense	probably benign	0.10
R5343:Mre11a	UTSW	9	14811834	missense	probably damaging	0.98
R5679:Mre11a	UTSW	9	14786919	missense	probably damaging	0.99
R5834:Mre11a	UTSW	9	14799657	missense	probably benign	0.15
R5914:Mre11a	UTSW	9	14811936	missense	probably damaging	1.00
R5935:Mre11a	UTSW	9	14786962	missense	probably damaging	1.00
R6089:Mre11a	UTSW	9	14819464	missense	probably benign	0.02
R6393:Mre11a	UTSW	9	14785509	start codon destroyed	probably null	0.00
R6625:Mre11a	UTSW	9	14805391	missense	possibly damaging	0.52
R7248:Mre11a	UTSW	9	14811913	missense	possibly damaging	0.52
R7744:Mre11a	UTSW	9	14809832	missense	possibly damaging	0.94
R7999:Mre11a	UTSW	9	14799669	nonsense	probably null
R8179:Mre11a	UTSW	9	14797066	missense	probably null	1.00
R9293:Mre11a	UTSW	9	14799588	missense	probably damaging	1.00
R9302:Mre11a	UTSW	9	14785530	critical splice donor site	probably null
R9368:Mre11a	UTSW	9	14825218	missense	probably benign
R9410:Mre11a	UTSW	9	14805420	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGTTCCCTTGCTGCTCTG -3'
(R):5'- TTATTTGCCTAGGAATAAATGAGGC -3'

Sequencing Primer
(F):5'- GTTCCCTTGCTGCTCTGAACTTATG -3'
(R):5'- TGTGTTTGACTCCAGAACCCAAG -3'

Posted On

2015-09-25