Mutagenetix > Incidental Mutation

Incidental Mutation 'R4612:Tlr9'

344846

Institutional Source

Beutler Lab

Gene Symbol

Tlr9

Ensembl Gene

ENSMUSG00000045322

Gene Name

toll-like receptor 9

Synonyms

MMRRC Submission

041823-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R4612 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106222598-106226883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106223807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 99 (P99L)

Ref Sequence

ENSEMBL: ENSMUSP00000082207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062241]

AlphaFold

Q9EQU3

PDB Structure

Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062241
AA Change: P99L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: P99L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019D03Rik	T	C	1: 52,925,476	D31G	probably benign	Het
5730455P16Rik	A	T	11: 80,377,980	M1K	probably null	Het
Abca15	A	G	7: 120,335,161	D120G	probably benign	Het
Adam26a	A	T	8: 43,568,793	N553K	probably damaging	Het
Adam32	A	T	8: 24,872,736	C558S	probably damaging	Het
Adam39	A	T	8: 40,825,921	S450C	probably damaging	Het
Agap2	A	T	10: 127,080,096	T159S	unknown	Het
Ahnak	G	A	19: 9,003,724	V791I	probably benign	Het
Ak7	T	G	12: 105,761,513	L468R	probably damaging	Het
Akap12	A	G	10: 4,354,456	D422G	probably damaging	Het
Antxr1	T	A	6: 87,288,173	I129F	probably damaging	Het
Arhgap32	G	A	9: 32,259,479	G1185D	probably damaging	Het
Atf7ip2	A	T	16: 10,241,563	E322D	probably benign	Het
Atg4b	T	C	1: 93,786,541	F349L	probably damaging	Het
Atp6v1c1	A	G	15: 38,677,612	K127R	probably damaging	Het
Atxn1l	C	T	8: 109,732,104	V509M	possibly damaging	Het
B3glct	T	A	5: 149,739,557	I260N	probably damaging	Het
Bcl2l12	G	A	7: 44,996,585	P70L	probably damaging	Het
Bok	T	A	1: 93,694,178	F157L	probably damaging	Het
Bves	G	A	10: 45,339,277	G16D	probably benign	Het
Cacna1b	T	A	2: 24,626,852	K65*	probably null	Het
Casc3	A	G	11: 98,822,958	T339A	probably benign	Het
Ccdc18	C	T	5: 108,135,441	S6L	probably benign	Het
Cd86	A	G	16: 36,615,330	Y242H	probably benign	Het
Chd3	A	C	11: 69,353,209	Y1249*	probably null	Het
Chrne	T	C	11: 70,617,022	T284A	probably damaging	Het
Col12a1	T	C	9: 79,616,057	D2746G	probably damaging	Het
Cryaa	T	A	17: 31,678,474	M72K	probably benign	Het
Csmd1	G	T	8: 15,921,908		probably null	Het
Det1	A	T	7: 78,843,706	N183K	probably damaging	Het
Dis3	C	A	14: 99,091,435	V294L	probably benign	Het
Dnah2	G	A	11: 69,483,367	L1493F	possibly damaging	Het
Dsc2	A	T	18: 20,041,819	D466E	probably damaging	Het
Dsg4	T	A	18: 20,462,413	S558T	probably benign	Het
Dzip3	A	T	16: 48,952,040	L422*	probably null	Het
Elp6	T	C	9: 110,314,019	F100S	probably damaging	Het
Epg5	C	T	18: 77,982,414	T1224I	possibly damaging	Het
F830016B08Rik	T	A	18: 60,301,015	I390N	probably benign	Het
Fam110c	A	G	12: 31,074,656	T206A	unknown	Het
Fam160a1	G	A	3: 85,730,372	R207*	probably null	Het
Fam187b	G	A	7: 30,977,093	G9D	possibly damaging	Het
Fat1	A	G	8: 45,025,147	D2410G	probably damaging	Het
Fbln1	T	A	15: 85,238,559	F390Y	probably benign	Het
Fgg	A	G	3: 83,010,090	N142S	probably damaging	Het
Flcn	T	C	11: 59,792,687	T555A	probably damaging	Het
Foxq1	G	T	13: 31,558,825		probably benign	Het
Gm3233	A	T	10: 77,759,664		probably benign	Het
Gm5346	A	T	8: 43,626,550	F212L	probably benign	Het
Gm7271	A	T	5: 76,516,498	N145Y	probably damaging	Het
Gprc5a	G	A	6: 135,078,929	V125I	probably damaging	Het
Gria2	T	C	3: 80,732,051	D218G	probably damaging	Het
Gtf3c5	C	T	2: 28,579,584	A103T	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Hspg2	A	G	4: 137,539,575	T1964A	possibly damaging	Het
Htatip2	G	T	7: 49,772,597	E188*	probably null	Het
Ifna13	T	G	4: 88,643,876	E170D	probably damaging	Het
Il4ra	A	G	7: 125,576,083	T488A	probably benign	Het
Jup	G	T	11: 100,381,834	H251N	probably damaging	Het
Kif21a	A	T	15: 90,968,223		probably null	Het
Klhl28	T	A	12: 64,957,260	I160L	probably damaging	Het
Klk5	A	T	7: 43,845,272	T60S	possibly damaging	Het
Kntc1	A	G	5: 123,812,643	R1995G	probably damaging	Het
Lrig2	A	C	3: 104,462,783	I844M	probably damaging	Het
Lrp2	C	T	2: 69,458,427	W3698*	probably null	Het
Lyar	T	A	5: 38,224,709	S12T	possibly damaging	Het
Map3k19	T	C	1: 127,815,300	K1507E	probably benign	Het
Mre11a	G	A	9: 14,802,903	G267R	probably damaging	Het
Mthfd1l	A	G	10: 4,030,717	Q473R	probably damaging	Het
Ncald	T	A	15: 37,397,349	E29V	probably benign	Het
Neb	T	C	2: 52,287,243	D1362G	probably damaging	Het
Nme2	T	C	11: 93,955,602	T7A	possibly damaging	Het
Nod2	T	A	8: 88,665,036	L657Q	possibly damaging	Het
Nrm	T	A	17: 35,863,529	V75E	probably benign	Het
Ogfod1	A	C	8: 94,037,347	K20T	possibly damaging	Het
Olfr197	T	C	16: 59,186,311	I57M	probably damaging	Het
Olfr294	T	A	7: 86,615,736	Q303L	probably benign	Het
Olfr63	T	A	17: 33,269,480	V252E	probably benign	Het
Omp	T	C	7: 98,145,141	N93S	probably damaging	Het
Pcdhb15	A	C	18: 37,475,595	T627P	probably damaging	Het
Pld1	A	G	3: 28,131,733	T1036A	possibly damaging	Het
Pogk	C	A	1: 166,398,765	E606*	probably null	Het
Ppp1r10	T	A	17: 35,927,931	L292Q	probably damaging	Het
Prpf6	T	C	2: 181,632,079	C339R	possibly damaging	Het
Psd	T	A	19: 46,313,339	D937V	probably benign	Het
Rbak	T	C	5: 143,174,467	Q277R	probably benign	Het
Sbno1	T	A	5: 124,404,024	Y355F	probably damaging	Het
Sec23ip	C	T	7: 128,750,502	Q201*	probably null	Het
Serpinb3a	T	C	1: 107,047,607	K157E	probably damaging	Het
Slc22a28	A	T	19: 8,101,406	N306K	probably damaging	Het
Smarca2	C	A	19: 26,776,225	D1584E	possibly damaging	Het
Snx29	C	A	16: 11,447,495	Q530K	probably damaging	Het
Stard10	C	A	7: 101,345,670	Q278K	possibly damaging	Het
Tgm2	C	T	2: 158,124,204	C510Y	probably benign	Het
Tmco4	T	C	4: 138,990,560	W4R	probably benign	Het
Tmem151a	T	A	19: 5,071,834		probably benign	Het
Tmem255b	T	C	8: 13,454,228	V140A	probably benign	Het
Trbj1-2	C	T	6: 41,534,016		probably benign	Het
Trpm2	T	C	10: 77,945,916	T290A	probably damaging	Het
Tsc22d1	G	A	14: 76,419,005	E120K	possibly damaging	Het
Ttc29	A	G	8: 78,325,546	D352G	probably benign	Het
Usp25	A	T	16: 77,033,945	I30F	possibly damaging	Het
Usp34	A	C	11: 23,432,268	N1993T	probably damaging	Het
Vmn2r124	A	C	17: 18,063,022	H326P	probably benign	Het
Vmn2r92	C	A	17: 18,166,870	T157K	probably benign	Het
Vstm5	A	T	9: 15,257,493	I118F	probably benign	Het
Vwa7	T	C	17: 35,023,450	V510A	probably damaging	Het
Zfhx4	G	A	3: 5,397,063	S1266N	probably damaging	Het
Zfp763	T	A	17: 33,018,948	N408Y	probably benign	Het
Zswim5	C	T	4: 116,986,704	H980Y	probably damaging	Het

Other mutations in Tlr9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Tlr9	APN	9	106225007	missense	probably damaging	1.00
IGL01764:Tlr9	APN	9	106225805	missense	probably damaging	1.00
IGL02077:Tlr9	APN	9	106225505	missense	possibly damaging	0.90
IGL02232:Tlr9	APN	9	106224937	missense	probably damaging	1.00
IGL02851:Tlr9	APN	9	106224730	nonsense	probably null
Asura	UTSW	9	106224647	missense	probably damaging	1.00
Cpg1	UTSW	9	106225007	missense	probably damaging	1.00
Cpg11	UTSW	9	106224586	missense	probably damaging	1.00
Cpg2	UTSW	9	106226465	missense	probably damaging	1.00
Cpg3	UTSW	9	106224152	missense	probably damaging	1.00
Cpg5	UTSW	9	106224689	missense	probably damaging	1.00
Cpg6	UTSW	9	106226593	missense	probably damaging	1.00
cpg7	UTSW	9	106225349	missense	probably benign	0.00
Meager	UTSW	9	106224139	missense	probably damaging	1.00
PIT4498001:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0126:Tlr9	UTSW	9	106225682	missense	probably benign	0.01
R0165:Tlr9	UTSW	9	106226087	missense	probably benign	0.10
R0534:Tlr9	UTSW	9	106224887	missense	probably benign	0.01
R0585:Tlr9	UTSW	9	106225076	missense	probably benign	0.01
R1527:Tlr9	UTSW	9	106223750	missense	probably benign	0.09
R1712:Tlr9	UTSW	9	106224049	missense	probably damaging	1.00
R1817:Tlr9	UTSW	9	106224943	missense	probably benign
R1940:Tlr9	UTSW	9	106224647	missense	probably damaging	1.00
R2117:Tlr9	UTSW	9	106225337	missense	probably damaging	1.00
R2656:Tlr9	UTSW	9	106223941	missense	probably benign	0.05
R3700:Tlr9	UTSW	9	106224079	missense	probably damaging	1.00
R4600:Tlr9	UTSW	9	106224533	missense	probably damaging	1.00
R4608:Tlr9	UTSW	9	106224974	missense	probably damaging	0.99
R4959:Tlr9	UTSW	9	106224677	missense	probably benign
R5173:Tlr9	UTSW	9	106225952	missense	possibly damaging	0.49
R5472:Tlr9	UTSW	9	106224313	missense	probably damaging	1.00
R5572:Tlr9	UTSW	9	106225637	missense	possibly damaging	0.47
R5618:Tlr9	UTSW	9	106224739	missense	possibly damaging	0.47
R5820:Tlr9	UTSW	9	106222707	critical splice donor site	probably null
R6393:Tlr9	UTSW	9	106224937	missense	probably damaging	1.00
R6397:Tlr9	UTSW	9	106225106	missense	probably damaging	1.00
R6455:Tlr9	UTSW	9	106223999	missense	probably damaging	1.00
R7385:Tlr9	UTSW	9	106225264	missense	probably damaging	1.00
R7455:Tlr9	UTSW	9	106224530	missense	probably benign	0.00
R7561:Tlr9	UTSW	9	106225949	missense	probably benign	0.00
R8889:Tlr9	UTSW	9	106222635	start gained	probably benign
R8892:Tlr9	UTSW	9	106222635	start gained	probably benign
R8926:Tlr9	UTSW	9	106226014	missense	probably benign
R9221:Tlr9	UTSW	9	106224773	missense	probably damaging	1.00
R9228:Tlr9	UTSW	9	106225553	missense	possibly damaging	0.49
R9581:Tlr9	UTSW	9	106224311	missense	probably damaging	1.00
R9689:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R9697:Tlr9	UTSW	9	106223524	nonsense	probably null
R9788:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
Z1176:Tlr9	UTSW	9	106223663	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGTGAGCTGAAGCCTCATG -3'
(R):5'- AGAACGCGCAGGCTGTATAG -3'

Sequencing Primer
(F):5'- CTCATGGCCTGGTGGACTG -3'
(R):5'- CTGTTAGCATCTAGAACCAGGATG -3'

Posted On

2015-09-25