Incidental Mutation 'R0103:Gnptab'
ID 34485
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene Name N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms EG432486
MMRRC Submission 038389-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R0103 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 10
Chromosomal Location 88214996-88283186 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88265381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 331 (Y331C)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
AlphaFold Q69ZN6
Predicted Effect probably damaging
Transcript: ENSMUST00000020251
AA Change: Y331C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: Y331C

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.9748 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,223,951 (GRCm39) R443S probably damaging Het
Anapc1 T C 2: 128,522,372 (GRCm39) probably benign Het
Aqr T A 2: 113,979,497 (GRCm39) I313F probably damaging Het
Arfgap3 A T 15: 83,206,922 (GRCm39) probably benign Het
Asah2 G T 19: 31,996,377 (GRCm39) H374N probably benign Het
Avl9 G T 6: 56,713,468 (GRCm39) R242L probably benign Het
Ccdc106 C A 7: 5,060,544 (GRCm39) Q35K probably benign Het
Ccm2l G T 2: 152,909,839 (GRCm39) E64* probably null Het
Cep85l A T 10: 53,154,270 (GRCm39) D776E possibly damaging Het
Cfap52 T A 11: 67,815,951 (GRCm39) I611F possibly damaging Het
Cldn22 C T 8: 48,277,589 (GRCm39) T9M probably benign Het
Coa7 T C 4: 108,195,338 (GRCm39) L89P possibly damaging Het
Cox7a2l A T 17: 83,821,701 (GRCm39) Y2N probably damaging Het
Ctns A C 11: 73,076,137 (GRCm39) I299M probably damaging Het
Cyp27a1 A C 1: 74,775,074 (GRCm39) E301A probably benign Het
Cyp2b13 A T 7: 25,788,135 (GRCm39) K421M probably damaging Het
Cyp4f40 G T 17: 32,895,282 (GRCm39) C468F probably damaging Het
Cyp4f40 C A 17: 32,895,283 (GRCm39) C468* probably null Het
Dcun1d5 G A 9: 7,188,788 (GRCm39) C74Y probably damaging Het
Dennd4c A G 4: 86,730,683 (GRCm39) Y860C probably benign Het
Dgkz T C 2: 91,764,550 (GRCm39) T1028A probably benign Het
Dhx58 T C 11: 100,586,096 (GRCm39) T642A probably damaging Het
Dlg4 A G 11: 69,922,019 (GRCm39) Y87C probably damaging Het
Dnah6 C T 6: 73,069,155 (GRCm39) E2511K probably damaging Het
Entpd5 C A 12: 84,443,717 (GRCm39) E9* probably null Het
Fbln2 A C 6: 91,248,532 (GRCm39) I1066L probably benign Het
Fhl2 C T 1: 43,192,381 (GRCm39) R4H probably benign Het
Frmpd1 T A 4: 45,229,884 (GRCm39) I17K probably damaging Het
Galnt2l A G 8: 122,996,472 (GRCm39) probably benign Het
Gbp7 T A 3: 142,252,299 (GRCm39) N627K probably benign Het
Hdac4 T C 1: 91,903,366 (GRCm39) E521G possibly damaging Het
Hibadh T A 6: 52,534,862 (GRCm39) M173L probably benign Het
Iba57 C T 11: 59,054,439 (GRCm39) A27T probably benign Het
Itga1 T C 13: 115,152,790 (GRCm39) I211V probably benign Het
Keg1 A T 19: 12,696,280 (GRCm39) I155F possibly damaging Het
Krt84 T C 15: 101,438,671 (GRCm39) E272G probably damaging Het
Lrp2 C A 2: 69,307,384 (GRCm39) V2892L probably benign Het
Ltb A G 17: 35,414,016 (GRCm39) probably benign Het
Masp1 G A 16: 23,276,768 (GRCm39) P579L probably damaging Het
Mtor T A 4: 148,618,359 (GRCm39) M1724K probably benign Het
Myo3a T G 2: 22,436,360 (GRCm39) probably benign Het
Myo9b C T 8: 71,776,493 (GRCm39) probably benign Het
Ncor1 G T 11: 62,233,871 (GRCm39) Q444K possibly damaging Het
Nek7 A T 1: 138,471,980 (GRCm39) C53* probably null Het
Obscn G T 11: 58,953,522 (GRCm39) Y4044* probably null Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Pcdh15 A T 10: 74,046,257 (GRCm39) D178V probably damaging Het
Pcsk6 T C 7: 65,578,845 (GRCm39) probably benign Het
Phxr4 T C 9: 13,343,087 (GRCm39) probably benign Het
Pkhd1 T A 1: 20,593,583 (GRCm39) D1510V probably benign Het
Pkhd1l1 T C 15: 44,460,537 (GRCm39) C4249R probably benign Het
Plxnb2 A G 15: 89,045,972 (GRCm39) Y968H possibly damaging Het
Prpf39 T C 12: 65,102,057 (GRCm39) V378A possibly damaging Het
Psd2 A G 18: 36,137,770 (GRCm39) N455S probably damaging Het
Ptch2 C A 4: 116,966,622 (GRCm39) probably benign Het
Rab4b A G 7: 26,873,927 (GRCm39) I117T probably benign Het
Rad9b A T 5: 122,469,590 (GRCm39) V348E probably damaging Het
Rcor1 T C 12: 111,076,212 (GRCm39) probably benign Het
Rhoc A T 3: 104,699,307 (GRCm39) E32V possibly damaging Het
Rnf40 T G 7: 127,199,743 (GRCm39) V925G probably damaging Het
Rptor G T 11: 119,775,793 (GRCm39) R988L probably benign Het
Slc25a32 A T 15: 38,963,292 (GRCm39) Y176* probably null Het
Slc7a1 T A 5: 148,289,236 (GRCm39) K4* probably null Het
Ss18 A C 18: 14,812,478 (GRCm39) Y38D probably damaging Het
Syt4 T A 18: 31,580,273 (GRCm39) probably benign Het
Taar4 A T 10: 23,837,304 (GRCm39) N305Y probably damaging Het
Taar7b A T 10: 23,876,192 (GRCm39) Y119F probably benign Het
Tcaf1 G T 6: 42,663,324 (GRCm39) D185E probably benign Het
Tmem138 T C 19: 10,552,316 (GRCm39) N62S possibly damaging Het
Tnfaip2 C T 12: 111,412,244 (GRCm39) T215M probably benign Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tnfrsf25 C T 4: 152,201,405 (GRCm39) P65S possibly damaging Het
Trp53bp1 A T 2: 121,067,240 (GRCm39) S495R possibly damaging Het
Trpv3 T C 11: 73,184,805 (GRCm39) F597S probably damaging Het
Tsc22d4 A C 5: 137,745,378 (GRCm39) M1L possibly damaging Het
Ttc39a A G 4: 109,278,650 (GRCm39) probably null Het
Ttn T G 2: 76,591,570 (GRCm39) H21033P probably damaging Het
Ugt2a3 A G 5: 87,484,577 (GRCm39) V149A possibly damaging Het
Ush2a T G 1: 188,051,267 (GRCm39) I251R possibly damaging Het
Vamp4 T C 1: 162,417,108 (GRCm39) C114R possibly damaging Het
Wdr33 T C 18: 31,966,388 (GRCm39) V135A probably damaging Het
Zc3h13 T A 14: 75,567,908 (GRCm39) V1067E probably damaging Het
Zcwpw1 G A 5: 137,808,375 (GRCm39) W274* probably null Het
Zfp219 T A 14: 52,244,163 (GRCm39) H627L probably damaging Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88,268,927 (GRCm39) missense probably damaging 0.99
IGL01346:Gnptab APN 10 88,272,041 (GRCm39) missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88,273,357 (GRCm39) missense probably damaging 0.98
IGL01642:Gnptab APN 10 88,271,994 (GRCm39) missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88,265,323 (GRCm39) missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88,276,151 (GRCm39) missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88,272,233 (GRCm39) missense possibly damaging 0.95
maze UTSW 10 88,268,435 (GRCm39) missense probably damaging 1.00
R0103:Gnptab UTSW 10 88,265,381 (GRCm39) missense probably damaging 1.00
R0114:Gnptab UTSW 10 88,269,262 (GRCm39) missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88,275,372 (GRCm39) missense probably damaging 0.98
R0288:Gnptab UTSW 10 88,268,967 (GRCm39) missense probably benign 0.00
R0329:Gnptab UTSW 10 88,276,171 (GRCm39) missense probably damaging 1.00
R0330:Gnptab UTSW 10 88,276,171 (GRCm39) missense probably damaging 1.00
R0369:Gnptab UTSW 10 88,269,456 (GRCm39) missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88,272,387 (GRCm39) missense probably damaging 1.00
R0522:Gnptab UTSW 10 88,267,328 (GRCm39) splice site probably benign
R0569:Gnptab UTSW 10 88,264,419 (GRCm39) missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88,279,166 (GRCm39) splice site probably benign
R0834:Gnptab UTSW 10 88,265,814 (GRCm39) missense probably damaging 1.00
R1375:Gnptab UTSW 10 88,268,435 (GRCm39) missense probably damaging 1.00
R1443:Gnptab UTSW 10 88,269,943 (GRCm39) missense probably damaging 1.00
R1464:Gnptab UTSW 10 88,281,616 (GRCm39) splice site probably benign
R1471:Gnptab UTSW 10 88,281,625 (GRCm39) missense probably benign
R1570:Gnptab UTSW 10 88,255,316 (GRCm39) missense probably damaging 0.99
R1612:Gnptab UTSW 10 88,264,344 (GRCm39) splice site probably null
R1614:Gnptab UTSW 10 88,250,451 (GRCm39) missense probably benign
R1638:Gnptab UTSW 10 88,272,029 (GRCm39) missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88,271,957 (GRCm39) missense probably benign 0.14
R1894:Gnptab UTSW 10 88,254,989 (GRCm39) missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88,276,167 (GRCm39) nonsense probably null
R2118:Gnptab UTSW 10 88,272,260 (GRCm39) missense probably benign 0.13
R2144:Gnptab UTSW 10 88,264,368 (GRCm39) missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88,269,906 (GRCm39) missense probably damaging 1.00
R3847:Gnptab UTSW 10 88,269,439 (GRCm39) nonsense probably null
R3943:Gnptab UTSW 10 88,269,756 (GRCm39) missense probably benign
R4434:Gnptab UTSW 10 88,248,484 (GRCm39) missense probably damaging 1.00
R4545:Gnptab UTSW 10 88,250,457 (GRCm39) missense probably benign 0.00
R4776:Gnptab UTSW 10 88,272,390 (GRCm39) missense probably damaging 1.00
R4786:Gnptab UTSW 10 88,272,044 (GRCm39) missense probably damaging 1.00
R4880:Gnptab UTSW 10 88,268,413 (GRCm39) nonsense probably null
R4889:Gnptab UTSW 10 88,269,775 (GRCm39) missense probably benign 0.00
R4923:Gnptab UTSW 10 88,265,485 (GRCm39) missense probably benign 0.17
R5694:Gnptab UTSW 10 88,250,348 (GRCm39) missense probably benign 0.01
R5943:Gnptab UTSW 10 88,269,376 (GRCm39) missense probably benign 0.00
R6027:Gnptab UTSW 10 88,269,087 (GRCm39) missense probably damaging 0.98
R6074:Gnptab UTSW 10 88,268,940 (GRCm39) missense probably damaging 1.00
R6119:Gnptab UTSW 10 88,267,257 (GRCm39) missense probably damaging 1.00
R6182:Gnptab UTSW 10 88,265,342 (GRCm39) missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88,273,364 (GRCm39) missense probably damaging 0.98
R6910:Gnptab UTSW 10 88,267,258 (GRCm39) missense probably damaging 1.00
R6911:Gnptab UTSW 10 88,267,258 (GRCm39) missense probably damaging 1.00
R7094:Gnptab UTSW 10 88,215,366 (GRCm39) missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88,276,174 (GRCm39) missense probably benign 0.19
R7164:Gnptab UTSW 10 88,269,932 (GRCm39) nonsense probably null
R7214:Gnptab UTSW 10 88,215,019 (GRCm39) unclassified probably benign
R7316:Gnptab UTSW 10 88,236,572 (GRCm39) missense probably damaging 1.00
R7463:Gnptab UTSW 10 88,267,251 (GRCm39) missense probably damaging 1.00
R7596:Gnptab UTSW 10 88,279,232 (GRCm39) missense probably damaging 0.99
R7654:Gnptab UTSW 10 88,281,681 (GRCm39) missense possibly damaging 0.63
R7722:Gnptab UTSW 10 88,215,390 (GRCm39) missense probably damaging 0.99
R7770:Gnptab UTSW 10 88,247,782 (GRCm39) missense probably benign 0.41
R7791:Gnptab UTSW 10 88,276,084 (GRCm39) critical splice acceptor site probably null
R7838:Gnptab UTSW 10 88,276,254 (GRCm39) critical splice donor site probably null
R8002:Gnptab UTSW 10 88,276,130 (GRCm39) missense probably benign 0.14
R8168:Gnptab UTSW 10 88,254,995 (GRCm39) missense probably benign 0.41
R8219:Gnptab UTSW 10 88,269,654 (GRCm39) missense probably benign
R8221:Gnptab UTSW 10 88,276,254 (GRCm39) critical splice donor site probably null
R8313:Gnptab UTSW 10 88,275,071 (GRCm39) missense probably damaging 1.00
R8351:Gnptab UTSW 10 88,250,348 (GRCm39) missense probably benign 0.01
R8487:Gnptab UTSW 10 88,268,508 (GRCm39) critical splice donor site probably null
R9108:Gnptab UTSW 10 88,269,400 (GRCm39) missense
R9352:Gnptab UTSW 10 88,268,350 (GRCm39) missense probably benign 0.05
R9489:Gnptab UTSW 10 88,268,992 (GRCm39) missense probably damaging 1.00
R9598:Gnptab UTSW 10 88,247,876 (GRCm39) missense probably damaging 0.97
R9760:Gnptab UTSW 10 88,267,310 (GRCm39) missense probably damaging 1.00
R9771:Gnptab UTSW 10 88,268,485 (GRCm39) missense probably damaging 1.00
X0064:Gnptab UTSW 10 88,272,392 (GRCm39) missense probably damaging 1.00
X0066:Gnptab UTSW 10 88,247,873 (GRCm39) missense probably damaging 0.99
Z1176:Gnptab UTSW 10 88,267,230 (GRCm39) missense probably damaging 1.00
Z1177:Gnptab UTSW 10 88,276,132 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAGAGCAGAGCAGGCA -3'
(R):5'- GAATGTGACTTTCAATAGCAGGGGAACT -3'

Sequencing Primer
(F):5'- GCAAAGGATGAAGACGAGCTG -3'
(R):5'- GACATCGTGAGATCACTGTACC -3'
Posted On 2013-05-09