Mutagenetix > Incidental Mutation

Incidental Mutation 'R4612:Trpm2'

344853

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

041823-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R4612 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77945916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 290 (T290A)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105400

Predicted Effect

probably damaging
Transcript: ENSMUST00000105401
AA Change: T290A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: T290A

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019D03Rik	T	C	1: 52,925,476	D31G	probably benign	Het
5730455P16Rik	A	T	11: 80,377,980	M1K	probably null	Het
Abca15	A	G	7: 120,335,161	D120G	probably benign	Het
Adam26a	A	T	8: 43,568,793	N553K	probably damaging	Het
Adam32	A	T	8: 24,872,736	C558S	probably damaging	Het
Adam39	A	T	8: 40,825,921	S450C	probably damaging	Het
Agap2	A	T	10: 127,080,096	T159S	unknown	Het
Ahnak	G	A	19: 9,003,724	V791I	probably benign	Het
Ak7	T	G	12: 105,761,513	L468R	probably damaging	Het
Akap12	A	G	10: 4,354,456	D422G	probably damaging	Het
Antxr1	T	A	6: 87,288,173	I129F	probably damaging	Het
Arhgap32	G	A	9: 32,259,479	G1185D	probably damaging	Het
Atf7ip2	A	T	16: 10,241,563	E322D	probably benign	Het
Atg4b	T	C	1: 93,786,541	F349L	probably damaging	Het
Atp6v1c1	A	G	15: 38,677,612	K127R	probably damaging	Het
Atxn1l	C	T	8: 109,732,104	V509M	possibly damaging	Het
B3glct	T	A	5: 149,739,557	I260N	probably damaging	Het
Bcl2l12	G	A	7: 44,996,585	P70L	probably damaging	Het
Bok	T	A	1: 93,694,178	F157L	probably damaging	Het
Bves	G	A	10: 45,339,277	G16D	probably benign	Het
Cacna1b	T	A	2: 24,626,852	K65*	probably null	Het
Casc3	A	G	11: 98,822,958	T339A	probably benign	Het
Ccdc18	C	T	5: 108,135,441	S6L	probably benign	Het
Cd86	A	G	16: 36,615,330	Y242H	probably benign	Het
Chd3	A	C	11: 69,353,209	Y1249*	probably null	Het
Chrne	T	C	11: 70,617,022	T284A	probably damaging	Het
Col12a1	T	C	9: 79,616,057	D2746G	probably damaging	Het
Cryaa	T	A	17: 31,678,474	M72K	probably benign	Het
Csmd1	G	T	8: 15,921,908		probably null	Het
Det1	A	T	7: 78,843,706	N183K	probably damaging	Het
Dis3	C	A	14: 99,091,435	V294L	probably benign	Het
Dnah2	G	A	11: 69,483,367	L1493F	possibly damaging	Het
Dsc2	A	T	18: 20,041,819	D466E	probably damaging	Het
Dsg4	T	A	18: 20,462,413	S558T	probably benign	Het
Dzip3	A	T	16: 48,952,040	L422*	probably null	Het
Elp6	T	C	9: 110,314,019	F100S	probably damaging	Het
Epg5	C	T	18: 77,982,414	T1224I	possibly damaging	Het
F830016B08Rik	T	A	18: 60,301,015	I390N	probably benign	Het
Fam110c	A	G	12: 31,074,656	T206A	unknown	Het
Fam160a1	G	A	3: 85,730,372	R207*	probably null	Het
Fam187b	G	A	7: 30,977,093	G9D	possibly damaging	Het
Fat1	A	G	8: 45,025,147	D2410G	probably damaging	Het
Fbln1	T	A	15: 85,238,559	F390Y	probably benign	Het
Fgg	A	G	3: 83,010,090	N142S	probably damaging	Het
Flcn	T	C	11: 59,792,687	T555A	probably damaging	Het
Foxq1	G	T	13: 31,558,825		probably benign	Het
Gm3233	A	T	10: 77,759,664		probably benign	Het
Gm5346	A	T	8: 43,626,550	F212L	probably benign	Het
Gm7271	A	T	5: 76,516,498	N145Y	probably damaging	Het
Gprc5a	G	A	6: 135,078,929	V125I	probably damaging	Het
Gria2	T	C	3: 80,732,051	D218G	probably damaging	Het
Gtf3c5	C	T	2: 28,579,584	A103T	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Hspg2	A	G	4: 137,539,575	T1964A	possibly damaging	Het
Htatip2	G	T	7: 49,772,597	E188*	probably null	Het
Ifna13	T	G	4: 88,643,876	E170D	probably damaging	Het
Il4ra	A	G	7: 125,576,083	T488A	probably benign	Het
Jup	G	T	11: 100,381,834	H251N	probably damaging	Het
Kif21a	A	T	15: 90,968,223		probably null	Het
Klhl28	T	A	12: 64,957,260	I160L	probably damaging	Het
Klk5	A	T	7: 43,845,272	T60S	possibly damaging	Het
Kntc1	A	G	5: 123,812,643	R1995G	probably damaging	Het
Lrig2	A	C	3: 104,462,783	I844M	probably damaging	Het
Lrp2	C	T	2: 69,458,427	W3698*	probably null	Het
Lyar	T	A	5: 38,224,709	S12T	possibly damaging	Het
Map3k19	T	C	1: 127,815,300	K1507E	probably benign	Het
Mre11a	G	A	9: 14,802,903	G267R	probably damaging	Het
Mthfd1l	A	G	10: 4,030,717	Q473R	probably damaging	Het
Ncald	T	A	15: 37,397,349	E29V	probably benign	Het
Neb	T	C	2: 52,287,243	D1362G	probably damaging	Het
Nme2	T	C	11: 93,955,602	T7A	possibly damaging	Het
Nod2	T	A	8: 88,665,036	L657Q	possibly damaging	Het
Nrm	T	A	17: 35,863,529	V75E	probably benign	Het
Ogfod1	A	C	8: 94,037,347	K20T	possibly damaging	Het
Olfr197	T	C	16: 59,186,311	I57M	probably damaging	Het
Olfr294	T	A	7: 86,615,736	Q303L	probably benign	Het
Olfr63	T	A	17: 33,269,480	V252E	probably benign	Het
Omp	T	C	7: 98,145,141	N93S	probably damaging	Het
Pcdhb15	A	C	18: 37,475,595	T627P	probably damaging	Het
Pld1	A	G	3: 28,131,733	T1036A	possibly damaging	Het
Pogk	C	A	1: 166,398,765	E606*	probably null	Het
Ppp1r10	T	A	17: 35,927,931	L292Q	probably damaging	Het
Prpf6	T	C	2: 181,632,079	C339R	possibly damaging	Het
Psd	T	A	19: 46,313,339	D937V	probably benign	Het
Rbak	T	C	5: 143,174,467	Q277R	probably benign	Het
Sbno1	T	A	5: 124,404,024	Y355F	probably damaging	Het
Sec23ip	C	T	7: 128,750,502	Q201*	probably null	Het
Serpinb3a	T	C	1: 107,047,607	K157E	probably damaging	Het
Slc22a28	A	T	19: 8,101,406	N306K	probably damaging	Het
Smarca2	C	A	19: 26,776,225	D1584E	possibly damaging	Het
Snx29	C	A	16: 11,447,495	Q530K	probably damaging	Het
Stard10	C	A	7: 101,345,670	Q278K	possibly damaging	Het
Tgm2	C	T	2: 158,124,204	C510Y	probably benign	Het
Tlr9	C	T	9: 106,223,807	P99L	probably damaging	Het
Tmco4	T	C	4: 138,990,560	W4R	probably benign	Het
Tmem151a	T	A	19: 5,071,834		probably benign	Het
Tmem255b	T	C	8: 13,454,228	V140A	probably benign	Het
Trbj1-2	C	T	6: 41,534,016		probably benign	Het
Tsc22d1	G	A	14: 76,419,005	E120K	possibly damaging	Het
Ttc29	A	G	8: 78,325,546	D352G	probably benign	Het
Usp25	A	T	16: 77,033,945	I30F	possibly damaging	Het
Usp34	A	C	11: 23,432,268	N1993T	probably damaging	Het
Vmn2r124	A	C	17: 18,063,022	H326P	probably benign	Het
Vmn2r92	C	A	17: 18,166,870	T157K	probably benign	Het
Vstm5	A	T	9: 15,257,493	I118F	probably benign	Het
Vwa7	T	C	17: 35,023,450	V510A	probably damaging	Het
Zfhx4	G	A	3: 5,397,063	S1266N	probably damaging	Het
Zfp763	T	A	17: 33,018,948	N408Y	probably benign	Het
Zswim5	C	T	4: 116,986,704	H980Y	probably damaging	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
R9457:Trpm2	UTSW	10	77911392	missense	possibly damaging	0.82
R9477:Trpm2	UTSW	10	77911390	missense	probably benign	0.12
R9547:Trpm2	UTSW	10	77912633	missense	probably benign	0.33
R9660:Trpm2	UTSW	10	77930555	missense	probably benign	0.00
R9663:Trpm2	UTSW	10	77920486	missense	probably benign	0.01
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GCCCATGAAGAAGCATTCAG -3'
(R):5'- CGCCCTATTTCCAGAATACAGG -3'

Sequencing Primer
(F):5'- TGAATACAGTCACGTTGTGAACCC -3'
(R):5'- CGAGTACATGCTGGATGAG -3'

Posted On

2015-09-25