Mutagenetix > Incidental Mutation

Incidental Mutation 'R4612:Dnah2'

344860

Institutional Source

Beutler Lab

Gene Symbol

Dnah2

Ensembl Gene

ENSMUSG00000005237

Gene Name

dynein, axonemal, heavy chain 2

Synonyms

Dnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik

MMRRC Submission

041823-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4612 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69420809-69549110 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 69483367 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1493 (L1493F)

Ref Sequence

ENSEMBL: ENSMUSP00000104299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035539
AA Change: L1493F

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: L1493F

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	273	429	6.6e-37	PFAM
Pfam:DHC_N1	432	761	1.3e-54	PFAM
Pfam:DHC_N2	1253	1668	3.4e-144	PFAM
AAA	1826	1962	2.95e-1	SMART
Pfam:AAA_5	2108	2251	1.3e-5	PFAM
AAA	2437	2584	3.63e-5	SMART
Pfam:AAA_8	2752	3022	1.1e-75	PFAM
Pfam:MT	3034	3370	8.7e-55	PFAM
Pfam:AAA_9	3386	3616	7.4e-68	PFAM
Pfam:Dynein_heavy	3748	4453	1.2e-220	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108659
AA Change: L1493F

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: L1493F

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	274	429	1.1e-47	PFAM
Pfam:DHC_N1	438	760	1.5e-75	PFAM
Pfam:DHC_N2	1255	1666	4.4e-144	PFAM
low complexity region	1711	1720	N/A	INTRINSIC
AAA	1832	1968	2.95e-1	SMART
Blast:AAA	2111	2251	2e-86	BLAST
AAA	2443	2590	3.63e-5	SMART
Pfam:AAA_8	2758	3028	5.5e-77	PFAM
Pfam:MT	3040	3376	7.6e-55	PFAM
Pfam:AAA_9	3396	3621	7.5e-94	PFAM
Pfam:Dynein_heavy	3759	4458	4.9e-264	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019D03Rik	T	C	1: 52,925,476	D31G	probably benign	Het
5730455P16Rik	A	T	11: 80,377,980	M1K	probably null	Het
Abca15	A	G	7: 120,335,161	D120G	probably benign	Het
Adam26a	A	T	8: 43,568,793	N553K	probably damaging	Het
Adam32	A	T	8: 24,872,736	C558S	probably damaging	Het
Adam39	A	T	8: 40,825,921	S450C	probably damaging	Het
Agap2	A	T	10: 127,080,096	T159S	unknown	Het
Ahnak	G	A	19: 9,003,724	V791I	probably benign	Het
Ak7	T	G	12: 105,761,513	L468R	probably damaging	Het
Akap12	A	G	10: 4,354,456	D422G	probably damaging	Het
Antxr1	T	A	6: 87,288,173	I129F	probably damaging	Het
Arhgap32	G	A	9: 32,259,479	G1185D	probably damaging	Het
Atf7ip2	A	T	16: 10,241,563	E322D	probably benign	Het
Atg4b	T	C	1: 93,786,541	F349L	probably damaging	Het
Atp6v1c1	A	G	15: 38,677,612	K127R	probably damaging	Het
Atxn1l	C	T	8: 109,732,104	V509M	possibly damaging	Het
B3glct	T	A	5: 149,739,557	I260N	probably damaging	Het
Bcl2l12	G	A	7: 44,996,585	P70L	probably damaging	Het
Bok	T	A	1: 93,694,178	F157L	probably damaging	Het
Bves	G	A	10: 45,339,277	G16D	probably benign	Het
Cacna1b	T	A	2: 24,626,852	K65*	probably null	Het
Casc3	A	G	11: 98,822,958	T339A	probably benign	Het
Ccdc18	C	T	5: 108,135,441	S6L	probably benign	Het
Cd86	A	G	16: 36,615,330	Y242H	probably benign	Het
Chd3	A	C	11: 69,353,209	Y1249*	probably null	Het
Chrne	T	C	11: 70,617,022	T284A	probably damaging	Het
Col12a1	T	C	9: 79,616,057	D2746G	probably damaging	Het
Cryaa	T	A	17: 31,678,474	M72K	probably benign	Het
Csmd1	G	T	8: 15,921,908		probably null	Het
Det1	A	T	7: 78,843,706	N183K	probably damaging	Het
Dis3	C	A	14: 99,091,435	V294L	probably benign	Het
Dsc2	A	T	18: 20,041,819	D466E	probably damaging	Het
Dsg4	T	A	18: 20,462,413	S558T	probably benign	Het
Dzip3	A	T	16: 48,952,040	L422*	probably null	Het
Elp6	T	C	9: 110,314,019	F100S	probably damaging	Het
Epg5	C	T	18: 77,982,414	T1224I	possibly damaging	Het
F830016B08Rik	T	A	18: 60,301,015	I390N	probably benign	Het
Fam110c	A	G	12: 31,074,656	T206A	unknown	Het
Fam160a1	G	A	3: 85,730,372	R207*	probably null	Het
Fam187b	G	A	7: 30,977,093	G9D	possibly damaging	Het
Fat1	A	G	8: 45,025,147	D2410G	probably damaging	Het
Fbln1	T	A	15: 85,238,559	F390Y	probably benign	Het
Fgg	A	G	3: 83,010,090	N142S	probably damaging	Het
Flcn	T	C	11: 59,792,687	T555A	probably damaging	Het
Foxq1	G	T	13: 31,558,825		probably benign	Het
Gm3233	A	T	10: 77,759,664		probably benign	Het
Gm5346	A	T	8: 43,626,550	F212L	probably benign	Het
Gm7271	A	T	5: 76,516,498	N145Y	probably damaging	Het
Gprc5a	G	A	6: 135,078,929	V125I	probably damaging	Het
Gria2	T	C	3: 80,732,051	D218G	probably damaging	Het
Gtf3c5	C	T	2: 28,579,584	A103T	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Hspg2	A	G	4: 137,539,575	T1964A	possibly damaging	Het
Htatip2	G	T	7: 49,772,597	E188*	probably null	Het
Ifna13	T	G	4: 88,643,876	E170D	probably damaging	Het
Il4ra	A	G	7: 125,576,083	T488A	probably benign	Het
Jup	G	T	11: 100,381,834	H251N	probably damaging	Het
Kif21a	A	T	15: 90,968,223		probably null	Het
Klhl28	T	A	12: 64,957,260	I160L	probably damaging	Het
Klk5	A	T	7: 43,845,272	T60S	possibly damaging	Het
Kntc1	A	G	5: 123,812,643	R1995G	probably damaging	Het
Lrig2	A	C	3: 104,462,783	I844M	probably damaging	Het
Lrp2	C	T	2: 69,458,427	W3698*	probably null	Het
Lyar	T	A	5: 38,224,709	S12T	possibly damaging	Het
Map3k19	T	C	1: 127,815,300	K1507E	probably benign	Het
Mre11a	G	A	9: 14,802,903	G267R	probably damaging	Het
Mthfd1l	A	G	10: 4,030,717	Q473R	probably damaging	Het
Ncald	T	A	15: 37,397,349	E29V	probably benign	Het
Neb	T	C	2: 52,287,243	D1362G	probably damaging	Het
Nme2	T	C	11: 93,955,602	T7A	possibly damaging	Het
Nod2	T	A	8: 88,665,036	L657Q	possibly damaging	Het
Nrm	T	A	17: 35,863,529	V75E	probably benign	Het
Ogfod1	A	C	8: 94,037,347	K20T	possibly damaging	Het
Olfr197	T	C	16: 59,186,311	I57M	probably damaging	Het
Olfr294	T	A	7: 86,615,736	Q303L	probably benign	Het
Olfr63	T	A	17: 33,269,480	V252E	probably benign	Het
Omp	T	C	7: 98,145,141	N93S	probably damaging	Het
Pcdhb15	A	C	18: 37,475,595	T627P	probably damaging	Het
Pld1	A	G	3: 28,131,733	T1036A	possibly damaging	Het
Pogk	C	A	1: 166,398,765	E606*	probably null	Het
Ppp1r10	T	A	17: 35,927,931	L292Q	probably damaging	Het
Prpf6	T	C	2: 181,632,079	C339R	possibly damaging	Het
Psd	T	A	19: 46,313,339	D937V	probably benign	Het
Rbak	T	C	5: 143,174,467	Q277R	probably benign	Het
Sbno1	T	A	5: 124,404,024	Y355F	probably damaging	Het
Sec23ip	C	T	7: 128,750,502	Q201*	probably null	Het
Serpinb3a	T	C	1: 107,047,607	K157E	probably damaging	Het
Slc22a28	A	T	19: 8,101,406	N306K	probably damaging	Het
Smarca2	C	A	19: 26,776,225	D1584E	possibly damaging	Het
Snx29	C	A	16: 11,447,495	Q530K	probably damaging	Het
Stard10	C	A	7: 101,345,670	Q278K	possibly damaging	Het
Tgm2	C	T	2: 158,124,204	C510Y	probably benign	Het
Tlr9	C	T	9: 106,223,807	P99L	probably damaging	Het
Tmco4	T	C	4: 138,990,560	W4R	probably benign	Het
Tmem151a	T	A	19: 5,071,834		probably benign	Het
Tmem255b	T	C	8: 13,454,228	V140A	probably benign	Het
Trbj1-2	C	T	6: 41,534,016		probably benign	Het
Trpm2	T	C	10: 77,945,916	T290A	probably damaging	Het
Tsc22d1	G	A	14: 76,419,005	E120K	possibly damaging	Het
Ttc29	A	G	8: 78,325,546	D352G	probably benign	Het
Usp25	A	T	16: 77,033,945	I30F	possibly damaging	Het
Usp34	A	C	11: 23,432,268	N1993T	probably damaging	Het
Vmn2r124	A	C	17: 18,063,022	H326P	probably benign	Het
Vmn2r92	C	A	17: 18,166,870	T157K	probably benign	Het
Vstm5	A	T	9: 15,257,493	I118F	probably benign	Het
Vwa7	T	C	17: 35,023,450	V510A	probably damaging	Het
Zfhx4	G	A	3: 5,397,063	S1266N	probably damaging	Het
Zfp763	T	A	17: 33,018,948	N408Y	probably benign	Het
Zswim5	C	T	4: 116,986,704	H980Y	probably damaging	Het

Other mutations in Dnah2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Dnah2	APN	11	69492672	missense	possibly damaging	0.93
IGL00418:Dnah2	APN	11	69495066	splice site	probably benign
IGL00772:Dnah2	APN	11	69451257	missense	probably damaging	0.97
IGL00819:Dnah2	APN	11	69473350	critical splice donor site	probably null
IGL00827:Dnah2	APN	11	69448457	missense	probably damaging	1.00
IGL01060:Dnah2	APN	11	69478092	missense	possibly damaging	0.86
IGL01340:Dnah2	APN	11	69493184	missense	probably damaging	0.99
IGL01349:Dnah2	APN	11	69475606	missense	probably damaging	0.99
IGL01413:Dnah2	APN	11	69432964	missense	probably damaging	0.99
IGL01451:Dnah2	APN	11	69474191	splice site	probably benign
IGL01480:Dnah2	APN	11	69458371	missense	possibly damaging	0.91
IGL01537:Dnah2	APN	11	69516080	missense	probably benign	0.17
IGL01592:Dnah2	APN	11	69431087	missense	probably benign	0.14
IGL01612:Dnah2	APN	11	69465063	splice site	probably benign
IGL01667:Dnah2	APN	11	69544395	missense	probably benign
IGL01667:Dnah2	APN	11	69520941	missense	probably damaging	0.98
IGL01691:Dnah2	APN	11	69539443	missense	probably benign
IGL02019:Dnah2	APN	11	69474285	missense	probably damaging	1.00
IGL02039:Dnah2	APN	11	69499212	missense	probably damaging	1.00
IGL02076:Dnah2	APN	11	69422559	missense	probably damaging	0.99
IGL02085:Dnah2	APN	11	69458185	missense	probably benign	0.07
IGL02158:Dnah2	APN	11	69458123	missense	probably benign
IGL02381:Dnah2	APN	11	69446292	missense	probably benign	0.25
IGL02681:Dnah2	APN	11	69452933	missense	probably benign	0.40
IGL02957:Dnah2	APN	11	69448507	missense	possibly damaging	0.96
IGL02961:Dnah2	APN	11	69518414	missense	probably damaging	1.00
IGL02969:Dnah2	APN	11	69521187	missense	possibly damaging	0.80
IGL03117:Dnah2	APN	11	69436291	splice site	probably benign
IGL03120:Dnah2	APN	11	69421848	missense	probably damaging	1.00
IGL03183:Dnah2	APN	11	69458488	missense	possibly damaging	0.94
IGL03197:Dnah2	APN	11	69459263	missense	probably damaging	1.00
IGL03263:Dnah2	APN	11	69529381	critical splice donor site	probably null
IGL03333:Dnah2	APN	11	69495123	missense	probably damaging	1.00
IGL03338:Dnah2	APN	11	69496577	missense	probably benign	0.13
argyrios	UTSW	11	69516590	missense	possibly damaging	0.47
Aureus	UTSW	11	69429348	missense	probably damaging	1.00
platinum	UTSW	11	69458042	missense	probably damaging	0.96
R0334_dnah2_144	UTSW	11	69436836	missense	probably damaging	1.00
R2150_dnah2_212	UTSW	11	69515761	missense	probably benign	0.14
BB005:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
BB015:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
E0370:Dnah2	UTSW	11	69515615	splice site	probably null
P0026:Dnah2	UTSW	11	69464947	missense	probably damaging	1.00
R0133:Dnah2	UTSW	11	69421009	missense	probably damaging	1.00
R0190:Dnah2	UTSW	11	69435249	missense	probably damaging	1.00
R0334:Dnah2	UTSW	11	69436836	missense	probably damaging	1.00
R0359:Dnah2	UTSW	11	69529531	missense	probably benign	0.00
R0386:Dnah2	UTSW	11	69447861	missense	probably damaging	1.00
R0414:Dnah2	UTSW	11	69499238	missense	probably benign	0.26
R0427:Dnah2	UTSW	11	69452879	missense	probably damaging	0.99
R0433:Dnah2	UTSW	11	69459288	missense	probably damaging	1.00
R0442:Dnah2	UTSW	11	69448542	missense	probably damaging	1.00
R0462:Dnah2	UTSW	11	69459201	missense	probably damaging	1.00
R0463:Dnah2	UTSW	11	69423126	missense	probably damaging	1.00
R0611:Dnah2	UTSW	11	69499194	missense	probably damaging	1.00
R0626:Dnah2	UTSW	11	69477683	missense	probably benign	0.07
R0924:Dnah2	UTSW	11	69421308	missense	probably damaging	1.00
R0968:Dnah2	UTSW	11	69448519	missense	possibly damaging	0.67
R1066:Dnah2	UTSW	11	69447819	missense	probably damaging	1.00
R1183:Dnah2	UTSW	11	69446648	missense	possibly damaging	0.95
R1184:Dnah2	UTSW	11	69499190	missense	probably damaging	1.00
R1186:Dnah2	UTSW	11	69515700	missense	probably damaging	0.99
R1453:Dnah2	UTSW	11	69451050	missense	probably damaging	0.99
R1498:Dnah2	UTSW	11	69520667	splice site	probably null
R1538:Dnah2	UTSW	11	69477202	missense	probably benign	0.17
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1590:Dnah2	UTSW	11	69422754	critical splice donor site	probably null
R1590:Dnah2	UTSW	11	69521198	missense	probably benign	0.00
R1655:Dnah2	UTSW	11	69473854	missense	probably damaging	1.00
R1695:Dnah2	UTSW	11	69514691	missense	possibly damaging	0.74
R1726:Dnah2	UTSW	11	69497889	missense	probably damaging	1.00
R1764:Dnah2	UTSW	11	69423543	missense	probably damaging	1.00
R1815:Dnah2	UTSW	11	69475574	missense	probably damaging	1.00
R1822:Dnah2	UTSW	11	69514804	missense	probably damaging	1.00
R1859:Dnah2	UTSW	11	69437886	missense	probably damaging	0.99
R1911:Dnah2	UTSW	11	69515752	missense	possibly damaging	0.64
R1913:Dnah2	UTSW	11	69464930	missense	probably damaging	1.00
R1981:Dnah2	UTSW	11	69474325	missense	probably damaging	1.00
R2010:Dnah2	UTSW	11	69458358	critical splice donor site	probably null
R2016:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2017:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2044:Dnah2	UTSW	11	69524240	missense	probably benign	0.14
R2077:Dnah2	UTSW	11	69496606	missense	possibly damaging	0.73
R2096:Dnah2	UTSW	11	69455916	missense	probably damaging	0.98
R2099:Dnah2	UTSW	11	69493237	missense	probably damaging	1.00
R2127:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2128:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2146:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2147:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2150:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2404:Dnah2	UTSW	11	69437221	missense	probably damaging	0.99
R2510:Dnah2	UTSW	11	69524206	nonsense	probably null
R2517:Dnah2	UTSW	11	69516644	missense	probably damaging	1.00
R3014:Dnah2	UTSW	11	69430478	missense	probably benign
R3741:Dnah2	UTSW	11	69448469	missense	probably damaging	1.00
R3814:Dnah2	UTSW	11	69492650	splice site	probably null
R3872:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3873:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3874:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3875:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3881:Dnah2	UTSW	11	69451347	missense	possibly damaging	0.94
R3953:Dnah2	UTSW	11	69454103	missense	probably damaging	1.00
R3956:Dnah2	UTSW	11	69484021	missense	probably benign	0.00
R4501:Dnah2	UTSW	11	69477659	missense	probably benign
R4515:Dnah2	UTSW	11	69465631	missense	possibly damaging	0.61
R4625:Dnah2	UTSW	11	69463661	missense	probably damaging	1.00
R4627:Dnah2	UTSW	11	69465376	missense	probably damaging	1.00
R4642:Dnah2	UTSW	11	69496559	missense	probably benign	0.00
R4683:Dnah2	UTSW	11	69458942	missense	probably damaging	1.00
R4698:Dnah2	UTSW	11	69498532	missense	probably damaging	1.00
R4710:Dnah2	UTSW	11	69478077	missense	probably damaging	1.00
R4712:Dnah2	UTSW	11	69516590	missense	possibly damaging	0.47
R4713:Dnah2	UTSW	11	69476688	missense	probably damaging	1.00
R4717:Dnah2	UTSW	11	69429357	missense	probably benign	0.00
R4740:Dnah2	UTSW	11	69458042	missense	probably damaging	0.96
R4780:Dnah2	UTSW	11	69473871	missense	probably damaging	0.97
R4825:Dnah2	UTSW	11	69423205	missense	probably damaging	1.00
R4864:Dnah2	UTSW	11	69422590	missense	probably damaging	0.98
R4868:Dnah2	UTSW	11	69463648	missense	probably damaging	1.00
R4879:Dnah2	UTSW	11	69476691	missense	probably damaging	1.00
R4908:Dnah2	UTSW	11	69521147	missense	probably benign	0.00
R4911:Dnah2	UTSW	11	69499104	critical splice donor site	probably null
R4954:Dnah2	UTSW	11	69539496	missense	possibly damaging	0.61
R4962:Dnah2	UTSW	11	69455973	nonsense	probably null
R5015:Dnah2	UTSW	11	69497882	missense	possibly damaging	0.89
R5049:Dnah2	UTSW	11	69448166	missense	probably damaging	1.00
R5055:Dnah2	UTSW	11	69520773	missense	possibly damaging	0.67
R5153:Dnah2	UTSW	11	69520933	missense	possibly damaging	0.84
R5155:Dnah2	UTSW	11	69422536	missense	probably damaging	1.00
R5186:Dnah2	UTSW	11	69435884	missense	probably damaging	1.00
R5187:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5208:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5252:Dnah2	UTSW	11	69529469	missense	probably damaging	0.98
R5296:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5298:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5299:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5301:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5324:Dnah2	UTSW	11	69457993	missense	probably benign	0.07
R5350:Dnah2	UTSW	11	69516036	missense	possibly damaging	0.48
R5377:Dnah2	UTSW	11	69421848	missense	probably damaging	1.00
R5393:Dnah2	UTSW	11	69500857	missense	probably benign
R5421:Dnah2	UTSW	11	69435636	missense	probably damaging	1.00
R5452:Dnah2	UTSW	11	69524383	missense	probably damaging	1.00
R5461:Dnah2	UTSW	11	69473351	critical splice donor site	probably null
R5474:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5476:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5477:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5510:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5527:Dnah2	UTSW	11	69437188	nonsense	probably null
R5566:Dnah2	UTSW	11	69516569	nonsense	probably null
R5587:Dnah2	UTSW	11	69437242	missense	probably damaging	1.00
R5628:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5688:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5690:Dnah2	UTSW	11	69491544	missense	probably benign	0.15
R5711:Dnah2	UTSW	11	69435390	missense	probably damaging	1.00
R5735:Dnah2	UTSW	11	69430817	missense	possibly damaging	0.93
R5826:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5913:Dnah2	UTSW	11	69448430	missense	probably damaging	1.00
R5914:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5960:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5961:Dnah2	UTSW	11	69431148	missense	probably damaging	1.00
R5961:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5977:Dnah2	UTSW	11	69520881	missense	possibly damaging	0.79
R6020:Dnah2	UTSW	11	69500839	missense	probably benign
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6050:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6086:Dnah2	UTSW	11	69516008	missense	probably benign	0.30
R6115:Dnah2	UTSW	11	69446649	missense	probably damaging	1.00
R6123:Dnah2	UTSW	11	69518359	missense	probably benign	0.29
R6159:Dnah2	UTSW	11	69458542	missense	probably damaging	1.00
R6159:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6163:Dnah2	UTSW	11	69520903	nonsense	probably null
R6171:Dnah2	UTSW	11	69423042	missense	probably damaging	1.00
R6263:Dnah2	UTSW	11	69457412	missense	probably damaging	1.00
R6298:Dnah2	UTSW	11	69491641	missense	probably benign	0.25
R6352:Dnah2	UTSW	11	69448227	missense	probably damaging	1.00
R6399:Dnah2	UTSW	11	69458518	missense	probably damaging	0.98
R6466:Dnah2	UTSW	11	69539415	missense	probably benign
R6478:Dnah2	UTSW	11	69516010	missense	probably benign	0.01
R6516:Dnah2	UTSW	11	69465386	missense	probably benign	0.34
R6538:Dnah2	UTSW	11	69437197	missense	possibly damaging	0.87
R6802:Dnah2	UTSW	11	69423690	missense	probably damaging	1.00
R6861:Dnah2	UTSW	11	69455963	missense	possibly damaging	0.64
R6869:Dnah2	UTSW	11	69429471	missense	probably damaging	1.00
R6894:Dnah2	UTSW	11	69484260	missense	probably benign	0.12
R6935:Dnah2	UTSW	11	69421741	missense	probably damaging	1.00
R7017:Dnah2	UTSW	11	69491547	nonsense	probably null
R7073:Dnah2	UTSW	11	69430492	nonsense	probably null
R7111:Dnah2	UTSW	11	69446753	splice site	probably null
R7125:Dnah2	UTSW	11	69436182	missense	probably damaging	0.99
R7137:Dnah2	UTSW	11	69491555	missense	probably damaging	1.00
R7190:Dnah2	UTSW	11	69549097	splice site	probably null
R7214:Dnah2	UTSW	11	69431109	missense	probably damaging	1.00
R7227:Dnah2	UTSW	11	69421396	missense	probably damaging	0.99
R7238:Dnah2	UTSW	11	69459146	critical splice donor site	probably null
R7256:Dnah2	UTSW	11	69431094	missense	probably damaging	1.00
R7267:Dnah2	UTSW	11	69500817	missense	probably damaging	1.00
R7420:Dnah2	UTSW	11	69478797	missense	possibly damaging	0.94
R7421:Dnah2	UTSW	11	69492805	missense	probably benign	0.25
R7437:Dnah2	UTSW	11	69498627	missense	probably damaging	1.00
R7461:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7473:Dnah2	UTSW	11	69491658	missense	probably damaging	0.99
R7528:Dnah2	UTSW	11	69500796	missense	probably damaging	0.99
R7613:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7615:Dnah2	UTSW	11	69435304	missense	probably damaging	0.99
R7626:Dnah2	UTSW	11	69498685	missense	probably damaging	0.99
R7745:Dnah2	UTSW	11	69451318	nonsense	probably null
R7764:Dnah2	UTSW	11	69458158	missense	probably benign	0.29
R7793:Dnah2	UTSW	11	69495214	missense	probably benign	0.00
R7819:Dnah2	UTSW	11	69516593	missense	probably benign	0.01
R7881:Dnah2	UTSW	11	69431238	missense	probably damaging	1.00
R7900:Dnah2	UTSW	11	69518428	missense	probably damaging	1.00
R7916:Dnah2	UTSW	11	69421148	critical splice acceptor site	probably null
R7921:Dnah2	UTSW	11	69520834	missense	probably benign
R7928:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
R7937:Dnah2	UTSW	11	69517685	nonsense	probably null
R7995:Dnah2	UTSW	11	69520737	missense	possibly damaging	0.77
R8202:Dnah2	UTSW	11	69478823	missense	probably benign	0.00
R8208:Dnah2	UTSW	11	69520852	missense	probably benign	0.05
R8215:Dnah2	UTSW	11	69435367	missense	probably damaging	1.00
R8279:Dnah2	UTSW	11	69475573	missense	probably damaging	1.00
R8338:Dnah2	UTSW	11	69487296	missense	probably damaging	1.00
R8348:Dnah2	UTSW	11	69429447	missense	possibly damaging	0.95
R8405:Dnah2	UTSW	11	69458463	missense	probably damaging	1.00
R8407:Dnah2	UTSW	11	69459278	missense	probably benign	0.00
R8493:Dnah2	UTSW	11	69452978	missense	probably damaging	1.00
R8673:Dnah2	UTSW	11	69514697	missense	probably benign	0.23
R8725:Dnah2	UTSW	11	69524179	missense	probably damaging	1.00
R8727:Dnah2	UTSW	11	69524179	missense	probably damaging	1.00
R8730:Dnah2	UTSW	11	69493261	missense	possibly damaging	0.73
R8804:Dnah2	UTSW	11	69465685	missense	probably benign	0.01
R8876:Dnah2	UTSW	11	69491522	missense	probably damaging	1.00
R8894:Dnah2	UTSW	11	69492222	missense	probably benign	0.01
R8938:Dnah2	UTSW	11	69437928	missense	probably damaging	0.99
R9044:Dnah2	UTSW	11	69529421	missense	probably benign
R9085:Dnah2	UTSW	11	69429398	missense	possibly damaging	0.69
R9110:Dnah2	UTSW	11	69544382	missense	probably benign
R9156:Dnah2	UTSW	11	69422861	missense
R9251:Dnah2	UTSW	11	69515793	missense	probably damaging	1.00
R9258:Dnah2	UTSW	11	69477253	missense	probably damaging	1.00
R9279:Dnah2	UTSW	11	69518278	missense	probably benign	0.01
R9318:Dnah2	UTSW	11	69484329	missense	probably benign	0.07
R9321:Dnah2	UTSW	11	69448113	critical splice donor site	probably null
R9350:Dnah2	UTSW	11	69493247	missense	probably benign	0.10
R9358:Dnah2	UTSW	11	69515766	missense	probably damaging	0.99
R9417:Dnah2	UTSW	11	69436164	missense	probably damaging	1.00
R9420:Dnah2	UTSW	11	69478116	missense	probably benign	0.09
R9438:Dnah2	UTSW	11	69473394	missense	probably damaging	1.00
R9469:Dnah2	UTSW	11	69431070	missense	probably damaging	1.00
R9487:Dnah2	UTSW	11	69515791	missense	possibly damaging	0.47
R9495:Dnah2	UTSW	11	69454382	missense	possibly damaging	0.89
R9579:Dnah2	UTSW	11	69477215	missense	probably damaging	1.00
R9608:Dnah2	UTSW	11	69454062	missense	probably null	1.00
R9651:Dnah2	UTSW	11	69450998	critical splice donor site	probably null
R9662:Dnah2	UTSW	11	69452937	missense	probably benign
RF004:Dnah2	UTSW	11	69437187	missense	probably benign	0.24
U24488:Dnah2	UTSW	11	69483822	missense	probably damaging	0.99
X0021:Dnah2	UTSW	11	69448562	missense	possibly damaging	0.81
Z1088:Dnah2	UTSW	11	69430793	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69421821	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69451120	missense	probably benign
Z1176:Dnah2	UTSW	11	69487054	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69498667	missense	probably benign	0.12
Z1176:Dnah2	UTSW	11	69516481	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69516523	missense	probably damaging	1.00
Z1177:Dnah2	UTSW	11	69463453	missense	possibly damaging	0.63
Z1177:Dnah2	UTSW	11	69544557	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTCAAATGCGTATAACCAGC -3'
(R):5'- TCAGAAGTGGTCTTACCCGG -3'

Sequencing Primer
(F):5'- CGTATAACCAGCGAAGGCCTG -3'
(R):5'- CTGGGAATTGAACTCAGGACCTCTG -3'

Posted On

2015-09-25