Mutagenetix > Incidental Mutation

Incidental Mutation 'R4612:Dsc2'

344891

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

041823-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4612 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20041819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 466 (D466E)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: D466E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: D466E

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: D466E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: D466E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019D03Rik	T	C	1: 52,925,476	D31G	probably benign	Het
5730455P16Rik	A	T	11: 80,377,980	M1K	probably null	Het
Abca15	A	G	7: 120,335,161	D120G	probably benign	Het
Adam26a	A	T	8: 43,568,793	N553K	probably damaging	Het
Adam32	A	T	8: 24,872,736	C558S	probably damaging	Het
Adam39	A	T	8: 40,825,921	S450C	probably damaging	Het
Agap2	A	T	10: 127,080,096	T159S	unknown	Het
Ahnak	G	A	19: 9,003,724	V791I	probably benign	Het
Ak7	T	G	12: 105,761,513	L468R	probably damaging	Het
Akap12	A	G	10: 4,354,456	D422G	probably damaging	Het
Antxr1	T	A	6: 87,288,173	I129F	probably damaging	Het
Arhgap32	G	A	9: 32,259,479	G1185D	probably damaging	Het
Atf7ip2	A	T	16: 10,241,563	E322D	probably benign	Het
Atg4b	T	C	1: 93,786,541	F349L	probably damaging	Het
Atp6v1c1	A	G	15: 38,677,612	K127R	probably damaging	Het
Atxn1l	C	T	8: 109,732,104	V509M	possibly damaging	Het
B3glct	T	A	5: 149,739,557	I260N	probably damaging	Het
Bcl2l12	G	A	7: 44,996,585	P70L	probably damaging	Het
Bok	T	A	1: 93,694,178	F157L	probably damaging	Het
Bves	G	A	10: 45,339,277	G16D	probably benign	Het
Cacna1b	T	A	2: 24,626,852	K65*	probably null	Het
Casc3	A	G	11: 98,822,958	T339A	probably benign	Het
Ccdc18	C	T	5: 108,135,441	S6L	probably benign	Het
Cd86	A	G	16: 36,615,330	Y242H	probably benign	Het
Chd3	A	C	11: 69,353,209	Y1249*	probably null	Het
Chrne	T	C	11: 70,617,022	T284A	probably damaging	Het
Col12a1	T	C	9: 79,616,057	D2746G	probably damaging	Het
Cryaa	T	A	17: 31,678,474	M72K	probably benign	Het
Csmd1	G	T	8: 15,921,908		probably null	Het
Det1	A	T	7: 78,843,706	N183K	probably damaging	Het
Dis3	C	A	14: 99,091,435	V294L	probably benign	Het
Dnah2	G	A	11: 69,483,367	L1493F	possibly damaging	Het
Dsg4	T	A	18: 20,462,413	S558T	probably benign	Het
Dzip3	A	T	16: 48,952,040	L422*	probably null	Het
Elp6	T	C	9: 110,314,019	F100S	probably damaging	Het
Epg5	C	T	18: 77,982,414	T1224I	possibly damaging	Het
F830016B08Rik	T	A	18: 60,301,015	I390N	probably benign	Het
Fam110c	A	G	12: 31,074,656	T206A	unknown	Het
Fam160a1	G	A	3: 85,730,372	R207*	probably null	Het
Fam187b	G	A	7: 30,977,093	G9D	possibly damaging	Het
Fat1	A	G	8: 45,025,147	D2410G	probably damaging	Het
Fbln1	T	A	15: 85,238,559	F390Y	probably benign	Het
Fgg	A	G	3: 83,010,090	N142S	probably damaging	Het
Flcn	T	C	11: 59,792,687	T555A	probably damaging	Het
Foxq1	G	T	13: 31,558,825		probably benign	Het
Gm3233	A	T	10: 77,759,664		probably benign	Het
Gm5346	A	T	8: 43,626,550	F212L	probably benign	Het
Gm7271	A	T	5: 76,516,498	N145Y	probably damaging	Het
Gprc5a	G	A	6: 135,078,929	V125I	probably damaging	Het
Gria2	T	C	3: 80,732,051	D218G	probably damaging	Het
Gtf3c5	C	T	2: 28,579,584	A103T	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Hspg2	A	G	4: 137,539,575	T1964A	possibly damaging	Het
Htatip2	G	T	7: 49,772,597	E188*	probably null	Het
Ifna13	T	G	4: 88,643,876	E170D	probably damaging	Het
Il4ra	A	G	7: 125,576,083	T488A	probably benign	Het
Jup	G	T	11: 100,381,834	H251N	probably damaging	Het
Kif21a	A	T	15: 90,968,223		probably null	Het
Klhl28	T	A	12: 64,957,260	I160L	probably damaging	Het
Klk5	A	T	7: 43,845,272	T60S	possibly damaging	Het
Kntc1	A	G	5: 123,812,643	R1995G	probably damaging	Het
Lrig2	A	C	3: 104,462,783	I844M	probably damaging	Het
Lrp2	C	T	2: 69,458,427	W3698*	probably null	Het
Lyar	T	A	5: 38,224,709	S12T	possibly damaging	Het
Map3k19	T	C	1: 127,815,300	K1507E	probably benign	Het
Mre11a	G	A	9: 14,802,903	G267R	probably damaging	Het
Mthfd1l	A	G	10: 4,030,717	Q473R	probably damaging	Het
Ncald	T	A	15: 37,397,349	E29V	probably benign	Het
Neb	T	C	2: 52,287,243	D1362G	probably damaging	Het
Nme2	T	C	11: 93,955,602	T7A	possibly damaging	Het
Nod2	T	A	8: 88,665,036	L657Q	possibly damaging	Het
Nrm	T	A	17: 35,863,529	V75E	probably benign	Het
Ogfod1	A	C	8: 94,037,347	K20T	possibly damaging	Het
Olfr197	T	C	16: 59,186,311	I57M	probably damaging	Het
Olfr294	T	A	7: 86,615,736	Q303L	probably benign	Het
Olfr63	T	A	17: 33,269,480	V252E	probably benign	Het
Omp	T	C	7: 98,145,141	N93S	probably damaging	Het
Pcdhb15	A	C	18: 37,475,595	T627P	probably damaging	Het
Pld1	A	G	3: 28,131,733	T1036A	possibly damaging	Het
Pogk	C	A	1: 166,398,765	E606*	probably null	Het
Ppp1r10	T	A	17: 35,927,931	L292Q	probably damaging	Het
Prpf6	T	C	2: 181,632,079	C339R	possibly damaging	Het
Psd	T	A	19: 46,313,339	D937V	probably benign	Het
Rbak	T	C	5: 143,174,467	Q277R	probably benign	Het
Sbno1	T	A	5: 124,404,024	Y355F	probably damaging	Het
Sec23ip	C	T	7: 128,750,502	Q201*	probably null	Het
Serpinb3a	T	C	1: 107,047,607	K157E	probably damaging	Het
Slc22a28	A	T	19: 8,101,406	N306K	probably damaging	Het
Smarca2	C	A	19: 26,776,225	D1584E	possibly damaging	Het
Snx29	C	A	16: 11,447,495	Q530K	probably damaging	Het
Stard10	C	A	7: 101,345,670	Q278K	possibly damaging	Het
Tgm2	C	T	2: 158,124,204	C510Y	probably benign	Het
Tlr9	C	T	9: 106,223,807	P99L	probably damaging	Het
Tmco4	T	C	4: 138,990,560	W4R	probably benign	Het
Tmem151a	T	A	19: 5,071,834		probably benign	Het
Tmem255b	T	C	8: 13,454,228	V140A	probably benign	Het
Trbj1-2	C	T	6: 41,534,016		probably benign	Het
Trpm2	T	C	10: 77,945,916	T290A	probably damaging	Het
Tsc22d1	G	A	14: 76,419,005	E120K	possibly damaging	Het
Ttc29	A	G	8: 78,325,546	D352G	probably benign	Het
Usp25	A	T	16: 77,033,945	I30F	possibly damaging	Het
Usp34	A	C	11: 23,432,268	N1993T	probably damaging	Het
Vmn2r124	A	C	17: 18,063,022	H326P	probably benign	Het
Vmn2r92	C	A	17: 18,166,870	T157K	probably benign	Het
Vstm5	A	T	9: 15,257,493	I118F	probably benign	Het
Vwa7	T	C	17: 35,023,450	V510A	probably damaging	Het
Zfhx4	G	A	3: 5,397,063	S1266N	probably damaging	Het
Zfp763	T	A	17: 33,018,948	N408Y	probably benign	Het
Zswim5	C	T	4: 116,986,704	H980Y	probably damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTAACCACAGTGAAGGAACAC -3'
(R):5'- TAATGCACTTCACCACCTGG -3'

Sequencing Primer
(F):5'- ACACAAGAAGTATCATGAGTCAAATC -3'
(R):5'- GGTCATCTACGTATTTCTTGTAGC -3'

Posted On

2015-09-25