Incidental Mutation 'R0103:Dlg4'
ID34490
Institutional Source Beutler Lab
Gene Symbol Dlg4
Ensembl Gene ENSMUSG00000020886
Gene Namediscs large MAGUK scaffold protein 4
SynonymsPSD95, Dlgh4, SAP90, PSD-95, SAP90A
MMRRC Submission 038389-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0103 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location70016942-70047522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70031193 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 87 (Y87C)
Ref Sequence ENSEMBL: ENSMUSP00000156246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018700] [ENSMUST00000108588] [ENSMUST00000108589] [ENSMUST00000123687] [ENSMUST00000124568] [ENSMUST00000132597] [ENSMUST00000133140] [ENSMUST00000134376] [ENSMUST00000135916] [ENSMUST00000143920] [ENSMUST00000231221] [ENSMUST00000231415] [ENSMUST00000231452] [ENSMUST00000231506] [ENSMUST00000231628] [ENSMUST00000232002] [ENSMUST00000232115] [ENSMUST00000232266]
Predicted Effect probably damaging
Transcript: ENSMUST00000018700
AA Change: Y87C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018700
Gene: ENSMUSG00000020886
AA Change: Y87C

DomainStartEndE-ValueType
MAGUK_N_PEST 10 64 1.36e-4 SMART
PDZ 73 152 3.38e-21 SMART
PDZ 168 247 1.12e-21 SMART
PDZ 321 394 4.13e-25 SMART
SH3 431 497 1.68e-9 SMART
GuKc 533 712 3.65e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108586
Predicted Effect probably damaging
Transcript: ENSMUST00000108588
AA Change: Y147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104229
Gene: ENSMUSG00000020886
AA Change: Y147C

DomainStartEndE-ValueType
MAGUK_N_PEST 10 61 1e-7 SMART
PDZ 70 149 3.38e-21 SMART
PDZ 165 244 1.12e-21 SMART
PDZ 318 391 4.13e-25 SMART
SH3 428 494 1.68e-9 SMART
GuKc 530 709 3.65e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108589
AA Change: Y190C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104230
Gene: ENSMUSG00000020886
AA Change: Y190C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
MAGUK_N_PEST 53 107 1.36e-4 SMART
PDZ 116 195 3.38e-21 SMART
PDZ 211 290 1.12e-21 SMART
PDZ 364 437 4.13e-25 SMART
SH3 474 540 1.68e-9 SMART
GuKc 576 755 3.65e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123687
AA Change: Y190C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134545
Gene: ENSMUSG00000020886
AA Change: Y190C

DomainStartEndE-ValueType
SH3 11 77 1.68e-9 SMART
GuKc 113 205 7.37e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124568
SMART Domains Protein: ENSMUSP00000121053
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
low complexity region 9 36 N/A INTRINSIC
MAGUK_N_PEST 69 123 7.67e-4 SMART
Pfam:PDZ 124 185 7.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132597
AA Change: Y119C

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114165
Gene: ENSMUSG00000020886
AA Change: Y119C

DomainStartEndE-ValueType
Pfam:MAGUK_N_PEST 2 43 5.8e-13 PFAM
PDZ 52 131 3.38e-21 SMART
PDZ 147 226 1.12e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133140
SMART Domains Protein: ENSMUSP00000126707
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
PDZ 13 92 3.38e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134376
AA Change: Y177C

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115206
Gene: ENSMUSG00000020886
AA Change: Y177C

DomainStartEndE-ValueType
MAGUK_N_PEST 10 97 3.39e-37 SMART
PDZ 106 165 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135916
SMART Domains Protein: ENSMUSP00000135994
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
Pfam:PDZ 5 51 6.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138004
Predicted Effect probably damaging
Transcript: ENSMUST00000143920
AA Change: Y87C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231221
AA Change: Y144C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231415
AA Change: Y144C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231452
AA Change: Y87C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231506
AA Change: Y187C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231628
AA Change: Y87C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232002
AA Change: Y125C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232115
AA Change: Y87C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232266
AA Change: Y116C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000232659
Meta Mutation Damage Score 0.2709 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. It heteromultimerizes with another MAGUK protein, DLG2, and is recruited into NMDA receptor and potassium channel clusters. These two MAGUK proteins may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severely impaired spatial learning, alterations in long-term potentiation and depression, and lack of hyperalgesia responses in a neuropathic pain model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,273,951 R443S probably damaging Het
Anapc1 T C 2: 128,680,452 probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arfgap3 A T 15: 83,322,721 probably benign Het
Asah2 G T 19: 32,018,977 H374N probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Ccdc106 C A 7: 5,057,545 Q35K probably benign Het
Ccm2l G T 2: 153,067,919 E64* probably null Het
Cep85l A T 10: 53,278,174 D776E possibly damaging Het
Cfap52 T A 11: 67,925,125 I611F possibly damaging Het
Cldn22 C T 8: 47,824,554 T9M probably benign Het
Coa7 T C 4: 108,338,141 L89P possibly damaging Het
Cox7a2l A T 17: 83,514,272 Y2N probably damaging Het
Ctns A C 11: 73,185,311 I299M probably damaging Het
Cyp27a1 A C 1: 74,735,915 E301A probably benign Het
Cyp2b13 A T 7: 26,088,710 K421M probably damaging Het
Cyp4f40 G T 17: 32,676,308 C468F probably damaging Het
Cyp4f40 C A 17: 32,676,309 C468* probably null Het
Dcun1d5 G A 9: 7,188,788 C74Y probably damaging Het
Dennd4c A G 4: 86,812,446 Y860C probably benign Het
Dgkz T C 2: 91,934,205 T1028A probably benign Het
Dhx58 T C 11: 100,695,270 T642A probably damaging Het
Dnah6 C T 6: 73,092,172 E2511K probably damaging Het
Entpd5 C A 12: 84,396,943 E9* probably null Het
Fbln2 A C 6: 91,271,550 I1066L probably benign Het
Fhl2 C T 1: 43,153,221 R4H probably benign Het
Frmpd1 T A 4: 45,229,884 I17K probably damaging Het
Gbp7 T A 3: 142,546,538 N627K probably benign Het
Gm20388 A G 8: 122,269,733 probably benign Het
Gnptab A G 10: 88,429,519 Y331C probably damaging Het
Hdac4 T C 1: 91,975,644 E521G possibly damaging Het
Hibadh T A 6: 52,557,877 M173L probably benign Het
Iba57 C T 11: 59,163,613 A27T probably benign Het
Itga1 T C 13: 115,016,254 I211V probably benign Het
Keg1 A T 19: 12,718,916 I155F possibly damaging Het
Krt84 T C 15: 101,530,236 E272G probably damaging Het
Lrp2 C A 2: 69,477,040 V2892L probably benign Het
Ltb A G 17: 35,195,040 probably benign Het
Masp1 G A 16: 23,458,018 P579L probably damaging Het
Mtor T A 4: 148,533,902 M1724K probably benign Het
Myo3a T G 2: 22,544,322 probably benign Het
Myo9b C T 8: 71,323,849 probably benign Het
Ncor1 G T 11: 62,343,045 Q444K possibly damaging Het
Nek7 A T 1: 138,544,242 C53* probably null Het
Obscn G T 11: 59,062,696 Y4044* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Pcdh15 A T 10: 74,210,425 D178V probably damaging Het
Pcsk6 T C 7: 65,929,097 probably benign Het
Phxr4 T C 9: 13,431,791 probably benign Het
Pkhd1 T A 1: 20,523,359 D1510V probably benign Het
Pkhd1l1 T C 15: 44,597,141 C4249R probably benign Het
Plxnb2 A G 15: 89,161,769 Y968H possibly damaging Het
Prpf39 T C 12: 65,055,283 V378A possibly damaging Het
Psd2 A G 18: 36,004,717 N455S probably damaging Het
Ptch2 C A 4: 117,109,425 probably benign Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rad9b A T 5: 122,331,527 V348E probably damaging Het
Rcor1 T C 12: 111,109,778 probably benign Het
Rhoc A T 3: 104,791,991 E32V possibly damaging Het
Rnf40 T G 7: 127,600,571 V925G probably damaging Het
Rptor G T 11: 119,884,967 R988L probably benign Het
Slc25a32 A T 15: 39,099,897 Y176* probably null Het
Slc7a1 T A 5: 148,352,426 K4* probably null Het
Ss18 A C 18: 14,679,421 Y38D probably damaging Het
Syt4 T A 18: 31,447,220 probably benign Het
Taar4 A T 10: 23,961,406 N305Y probably damaging Het
Taar7b A T 10: 24,000,294 Y119F probably benign Het
Tcaf1 G T 6: 42,686,390 D185E probably benign Het
Tmem138 T C 19: 10,574,952 N62S possibly damaging Het
Tnfaip2 C T 12: 111,445,810 T215M probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnfrsf25 C T 4: 152,116,948 P65S possibly damaging Het
Trp53bp1 A T 2: 121,236,759 S495R possibly damaging Het
Trpv3 T C 11: 73,293,979 F597S probably damaging Het
Tsc22d4 A C 5: 137,747,116 M1L possibly damaging Het
Ttc39a A G 4: 109,421,453 probably null Het
Ttn T G 2: 76,761,226 H21033P probably damaging Het
Ugt2a3 A G 5: 87,336,718 V149A possibly damaging Het
Ush2a T G 1: 188,319,070 I251R possibly damaging Het
Vamp4 T C 1: 162,589,539 C114R possibly damaging Het
Wdr33 T C 18: 31,833,335 V135A probably damaging Het
Zc3h13 T A 14: 75,330,468 V1067E probably damaging Het
Zcwpw1 G A 5: 137,810,113 W274* probably null Het
Zfp219 T A 14: 52,006,706 H627L probably damaging Het
Other mutations in Dlg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Dlg4 APN 11 70041347 missense probably damaging 1.00
IGL02260:Dlg4 APN 11 70042267 missense probably damaging 1.00
IGL03097:Dlg4 UTSW 11 70042202 missense probably damaging 1.00
R0103:Dlg4 UTSW 11 70031193 missense probably damaging 1.00
R0628:Dlg4 UTSW 11 70031784 missense probably damaging 1.00
R0734:Dlg4 UTSW 11 70042705 missense probably damaging 1.00
R1587:Dlg4 UTSW 11 70031746 missense possibly damaging 0.88
R1946:Dlg4 UTSW 11 70039575 missense probably damaging 1.00
R2190:Dlg4 UTSW 11 70042604 missense probably damaging 1.00
R2259:Dlg4 UTSW 11 70031370 missense probably damaging 1.00
R2289:Dlg4 UTSW 11 70026926 missense probably damaging 1.00
R2411:Dlg4 UTSW 11 70041929 critical splice donor site probably null
R3161:Dlg4 UTSW 11 70017225 missense probably damaging 0.99
R4059:Dlg4 UTSW 11 70027083 missense probably benign
R4782:Dlg4 UTSW 11 70026954 missense probably damaging 1.00
R4910:Dlg4 UTSW 11 70030925 missense probably damaging 1.00
R5077:Dlg4 UTSW 11 70027026 missense possibly damaging 0.71
R5557:Dlg4 UTSW 11 70042280 missense probably damaging 1.00
R5996:Dlg4 UTSW 11 70017231 missense probably benign 0.00
R6649:Dlg4 UTSW 11 70023953 unclassified probably benign
R6653:Dlg4 UTSW 11 70023953 unclassified probably benign
R7155:Dlg4 UTSW 11 70017216 start codon destroyed probably null 0.00
R7284:Dlg4 UTSW 11 70042082 nonsense probably null
R7683:Dlg4 UTSW 11 70039854 missense possibly damaging 0.95
Z1088:Dlg4 UTSW 11 70031130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTTGACGGAATTAGGCGGTAAG -3'
(R):5'- ATGCTGAAGCCAAGTCCTGGATG -3'

Sequencing Primer
(F):5'- ACCAAGATCATTCCTGGTGG -3'
(R):5'- CCAAGTCCTGGATGGGAGG -3'
Posted On2013-05-09